ID: 972662877

View in Genome Browser
Species Human (GRCh38)
Location 4:41133781-41133803
Sequence AACAAGGAGTGCAGAGTAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 0, 2: 8, 3: 24, 4: 345}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972662869_972662877 6 Left 972662869 4:41133752-41133774 CCCCACTGAAAAATTCTAGGCAG 0: 1
1: 0
2: 1
3: 13
4: 152
Right 972662877 4:41133781-41133803 AACAAGGAGTGCAGAGTAAGGGG 0: 1
1: 0
2: 8
3: 24
4: 345
972662870_972662877 5 Left 972662870 4:41133753-41133775 CCCACTGAAAAATTCTAGGCAGC 0: 1
1: 0
2: 1
3: 12
4: 120
Right 972662877 4:41133781-41133803 AACAAGGAGTGCAGAGTAAGGGG 0: 1
1: 0
2: 8
3: 24
4: 345
972662865_972662877 21 Left 972662865 4:41133737-41133759 CCTTGGTCCCTCTCTCCCCACTG 0: 1
1: 0
2: 8
3: 99
4: 730
Right 972662877 4:41133781-41133803 AACAAGGAGTGCAGAGTAAGGGG 0: 1
1: 0
2: 8
3: 24
4: 345
972662871_972662877 4 Left 972662871 4:41133754-41133776 CCACTGAAAAATTCTAGGCAGCT 0: 1
1: 0
2: 1
3: 9
4: 190
Right 972662877 4:41133781-41133803 AACAAGGAGTGCAGAGTAAGGGG 0: 1
1: 0
2: 8
3: 24
4: 345
972662867_972662877 13 Left 972662867 4:41133745-41133767 CCTCTCTCCCCACTGAAAAATTC 0: 1
1: 0
2: 3
3: 32
4: 318
Right 972662877 4:41133781-41133803 AACAAGGAGTGCAGAGTAAGGGG 0: 1
1: 0
2: 8
3: 24
4: 345
972662866_972662877 14 Left 972662866 4:41133744-41133766 CCCTCTCTCCCCACTGAAAAATT 0: 1
1: 0
2: 2
3: 41
4: 419
Right 972662877 4:41133781-41133803 AACAAGGAGTGCAGAGTAAGGGG 0: 1
1: 0
2: 8
3: 24
4: 345

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972662877 Original CRISPR AACAAGGAGTGCAGAGTAAG GGG Intronic
902268656 1:15287475-15287497 AAGGAGAAGTGCAGAGCAAGGGG + Intronic
904541723 1:31238346-31238368 AACAAGGAGTCCAGCATGAGGGG + Intronic
904922120 1:34015990-34016012 AGCAAGGAGTCCAGTGTAAATGG - Intronic
905162841 1:36051923-36051945 GACAAAGAATGCAGAGAAAGGGG + Intronic
905607071 1:39310979-39311001 ATTAAGGATTGCAGAGCAAGAGG + Exonic
907132823 1:52111666-52111688 AACAAGTAGTGCAGAGGACCTGG - Intergenic
907591955 1:55683060-55683082 GTCAATGAGTGCATAGTAAGTGG - Intergenic
907683613 1:56588231-56588253 AAGGAGAAGTGCAGAGCAAGTGG + Intronic
908576107 1:65461590-65461612 AACAAGTAGTGGAGAATAGGTGG + Intronic
908800153 1:67871761-67871783 AACAAGGAGTTGAGAGAAGGGGG - Intergenic
909405409 1:75282736-75282758 AAGAAGAAGTGCAGAGCAAAGGG - Intronic
909601254 1:77463991-77464013 AACATAGAAGGCAGAGTAAGTGG - Intronic
910274600 1:85435579-85435601 GAAAAGTAGTGAAGAGTAAGGGG + Intronic
910823726 1:91382272-91382294 AAAAAGTAGAGCAGGGTAAGCGG - Intronic
911084993 1:93968918-93968940 AAAAAGCAGAGCAGAGTAAAGGG + Intergenic
911881162 1:103239820-103239842 AGCAAAGAGGGCAGAGTAAATGG - Intergenic
912897977 1:113613817-113613839 TACAAGGAATGCAGACAAAGTGG + Intronic
913267603 1:117060273-117060295 AACAAAGAGGGCGGAGTAAAAGG + Intergenic
913380306 1:118203108-118203130 ATCAAAGAAGGCAGAGTAAGGGG - Intergenic
913498318 1:119448351-119448373 AACAAGGAAAGCAGACTCAGTGG + Intergenic
913536521 1:119778129-119778151 AACAAGGAGTTGAGGGTAATTGG + Intergenic
913671501 1:121100718-121100740 AACAAGAAGTGGAGAATAAAGGG - Intergenic
914023272 1:143888154-143888176 AACAAGAAGTGGAGAATAAAGGG - Intergenic
914045617 1:144089519-144089541 AGAAAGGAGTGCAGAGTAAGAGG - Intergenic
914132493 1:144871167-144871189 AGAAAGGAGTGCAGAGTAAGAGG + Intergenic
914919975 1:151839850-151839872 GAAAAGGAGTGGAGAGTAGGAGG - Intronic
915960707 1:160264029-160264051 AAAAAACAGTGCAGAGTAAGGGG - Intergenic
916509812 1:165462511-165462533 GAAAATGAGTGCAGAGTAAATGG + Intergenic
917564225 1:176195101-176195123 AAAAAGGAGAGGAGAGAAAGAGG + Intronic
918440081 1:184558135-184558157 AATAAGAAGTGGTGAGTAAGAGG - Intronic
918698833 1:187581110-187581132 ACCCAGGAGTGCTGAGTATGTGG - Intergenic
919011861 1:191975027-191975049 AAAAAGAAGTGCAGAGCAAAAGG + Intergenic
919091745 1:192985819-192985841 AGCAAGGAGTCCAGAGTAGTTGG + Intergenic
920670154 1:207997847-207997869 AAAAAGGAGTGAGGAGAAAGAGG + Intergenic
921268918 1:213449690-213449712 AACACAGAATGCAGAGAAAGTGG - Intergenic
921782096 1:219176993-219177015 AACAAGGAAAGCAGGATAAGGGG + Intronic
921866664 1:220094126-220094148 ACCAAGGGGAGCCGAGTAAGAGG - Exonic
923503201 1:234583399-234583421 AACAAGGACTACAGAGCTAGGGG - Intergenic
1062926442 10:1319023-1319045 TTCAAGGAGCTCAGAGTAAGTGG + Intronic
1063376818 10:5558928-5558950 AACAAGGAGTGCACTGTCTGAGG + Intergenic
1063953637 10:11246680-11246702 TCCAAGGAGAGCAGAGTGAGGGG - Intronic
1064018036 10:11787860-11787882 AAGAAAGACTGCAGAGAAAGAGG + Intergenic
1064154251 10:12890460-12890482 ATCAAAGTGTGCAGACTAAGAGG - Intergenic
1064844989 10:19641926-19641948 AACAAGTAGTTCAGAATAATAGG + Intronic
1065889556 10:30109549-30109571 CACAAGGAGAGCAGAGTGACAGG - Intronic
1066117366 10:32252616-32252638 AACCAGGAGTGGAGAGAAAAGGG - Intergenic
1067464708 10:46489221-46489243 CACAAGGAGTGAACAGTGAGGGG - Intergenic
1067622486 10:47895432-47895454 CACAAGGAGTGAACAGTGAGGGG + Intergenic
1067816925 10:49486040-49486062 AAAAAGGAGTGAACAGAAAGAGG + Intronic
1070353456 10:75615717-75615739 AACCAGGAGAGCAGAGTTAATGG + Intronic
1070711532 10:78686686-78686708 GACAAGGGCTGCAGAGTAAGAGG + Intergenic
1071119796 10:82264310-82264332 AAGAATGAGTGCTGAGCAAGGGG + Intronic
1071924494 10:90390185-90390207 AAGACGGAGGGGAGAGTAAGAGG + Intergenic
1073391830 10:103184437-103184459 AACAAGTAAAGCAGGGTAAGAGG - Intronic
1074724456 10:116293702-116293724 AACAAGGGATGCAGAGGAAAAGG + Intergenic
1075609334 10:123839106-123839128 CATAATAAGTGCAGAGTAAGTGG - Intronic
1075839661 10:125489906-125489928 AACAATGAGTGGCGAATAAGTGG + Intergenic
1076657624 10:132035565-132035587 AGCAAGGATTGCAGAGGGAGTGG - Intergenic
1077975048 11:7239230-7239252 AACAGGAAGTGCAGAAGAAGGGG + Intronic
1077979697 11:7287213-7287235 AGCAAGAAGTGCAGAGTGAAGGG + Intronic
1078267816 11:9767896-9767918 AACAAGAAGTGCTGAGCAAAAGG - Intergenic
1079496739 11:21052821-21052843 AACAAGGAGTCCAGTGTCTGTGG + Intronic
1080649113 11:34208945-34208967 AGCAAGGTGACCAGAGTAAGGGG - Intronic
1080849080 11:36052235-36052257 AACAGGGAGTGCTAAGTAATGGG + Intronic
1080884209 11:36350386-36350408 AAGAGGGAGTGAAGAATAAGAGG + Intronic
1081496171 11:43612786-43612808 AAGAAGAAGGGCAGAGTATGTGG + Intronic
1087095337 11:94312517-94312539 AACAAGGAGGCCAGAGAAATTGG - Intergenic
1087095738 11:94315756-94315778 AACAAGGAGGCCAGAGAAATTGG + Intergenic
1088113065 11:106284243-106284265 AAAAAGGAGTACAGTATAAGTGG - Intergenic
1088321574 11:108559576-108559598 AACTAGCAGTGCAGAGGATGTGG - Intronic
1088851072 11:113703759-113703781 AGAAAGAAGTGCAGAGTAAAGGG - Intronic
1088987901 11:114926216-114926238 ATCAAGGAGAGGAGACTAAGTGG - Intergenic
1089239512 11:117064371-117064393 AAAAAGGAGTTAAGAGTGAGAGG - Intronic
1089526217 11:119098525-119098547 ACCAAGGTTTGCAGAGGAAGTGG - Intronic
1089743426 11:120600586-120600608 AGCCAGGAGTGCAGAGGCAGGGG + Intronic
1089750887 11:120650268-120650290 ACCAAGGGGTGCAGAGGGAGAGG + Intronic
1090373657 11:126274286-126274308 TACAAGGAGTGGAGAGGAGGTGG + Intronic
1090667011 11:128921004-128921026 ACCAAGGCGAGCCGAGTAAGTGG - Exonic
1090962912 11:131573045-131573067 AGGAGGGAGTGCAGAGTCAGTGG - Intronic
1091254434 11:134171713-134171735 AACCTGGAGTGCAGAGTACATGG - Intronic
1091412934 12:256076-256098 AACAAGGAGAGCTGGGTAAAGGG - Intronic
1092105199 12:5916792-5916814 AGCAGGCAGTGCAGAGTCAGGGG + Intronic
1092991357 12:13904560-13904582 AAGATGGAGTGAAGAGCAAGTGG - Intronic
1093232445 12:16563588-16563610 AGTAAAGAGTGCAGAGGAAGAGG - Intronic
1093283222 12:17222832-17222854 AAAAAGGAAAGCAGAGTATGAGG + Intergenic
1094094733 12:26690674-26690696 ACCAAGGAGTGTAGGGTAGGAGG - Intronic
1095381607 12:41601102-41601124 TGCAGGGAGTGCAGAGTAGGAGG + Intergenic
1096245953 12:49986564-49986586 AGCAAGAAGTGCAGAGCAAAAGG + Intronic
1097200141 12:57271256-57271278 CAAAAGGAGGGCAGAGTGAGTGG + Intronic
1099086151 12:78248045-78248067 AAAAAAGAGACCAGAGTAAGGGG + Intergenic
1100320043 12:93482288-93482310 AACAAGGAGTGCAGGAGCAGAGG - Intronic
1101137948 12:101764840-101764862 AACAAGGAGAGCCCAGGAAGAGG - Exonic
1101251096 12:102937042-102937064 AAGAAGGAGTGCCAAGCAAGAGG - Intronic
1102702578 12:114852394-114852416 ACCAGGGTGTGCAGAGGAAGGGG - Intergenic
1102781681 12:115571051-115571073 AAAAAGTAGAACAGAGTAAGAGG + Intergenic
1102954691 12:117051901-117051923 AAAATGGAGTGGAGAGCAAGTGG - Intronic
1103859760 12:124002967-124002989 AACAAGGAGTGGCTAGTGAGGGG + Intronic
1105048480 12:133027163-133027185 GACAAGGAATGAAGATTAAGAGG + Intergenic
1105677912 13:22694920-22694942 AAGAGGGAATGAAGAGTAAGAGG - Intergenic
1105932554 13:25066580-25066602 TAGAAGGTGTTCAGAGTAAGAGG + Intergenic
1107559959 13:41550008-41550030 AACCTGGAGTGCAGAGACAGAGG + Intergenic
1109230070 13:59745849-59745871 AACAAGCAGAGCAGAGTAGTTGG - Intronic
1109348959 13:61151979-61152001 AACAAGAAGTGCTGAGGGAGTGG + Intergenic
1109513321 13:63407200-63407222 TAAAAGGAGTTTAGAGTAAGTGG - Intergenic
1110544370 13:76739605-76739627 ACCAGGGAGTGCCGAGTAACTGG - Intergenic
1111091669 13:83453950-83453972 AACGAGGAGTGGAGAATGAGGGG - Intergenic
1111369246 13:87294772-87294794 AATGATGAGAGCAGAGTAAGGGG - Intergenic
1111520204 13:89391706-89391728 ATAAAGGGATGCAGAGTAAGAGG + Intergenic
1111720886 13:91943823-91943845 AAGAAGGAATGCAGATTTAGAGG - Intronic
1112624087 13:101082712-101082734 AACACAGAGAGGAGAGTAAGTGG + Intronic
1113824573 13:113241417-113241439 ACCAAAGGGTGTAGAGTAAGAGG + Intronic
1114841603 14:26269090-26269112 AACAAGGTGAGCAGAGAAACTGG - Intergenic
1116246649 14:42423301-42423323 AACAAGGAGTTAAGATTTAGTGG + Intergenic
1117713532 14:58557434-58557456 AACAGGGACTGCACAGTATGTGG + Intergenic
1117726301 14:58677921-58677943 CAGAAGGAGGGCAGAGAAAGGGG - Intergenic
1121016815 14:90553956-90553978 AATTAGCAGTGCAGAGTAATGGG + Intronic
1121496536 14:94395650-94395672 AGCAAGGAGTGGAGAGAAAAGGG - Intergenic
1125130120 15:36274782-36274804 AACAAGGAGCATAAAGTAAGGGG - Intergenic
1125542520 15:40478298-40478320 AAGAAGGAGGGCAGAGGCAGTGG - Intergenic
1126388179 15:48115851-48115873 AACAAGAAATCCAGAGAAAGAGG + Intergenic
1127713839 15:61627816-61627838 AATCAGGAGTGCAGGATAAGAGG + Intergenic
1127967062 15:63930289-63930311 AACAGTGAGTGTGGAGTAAGGGG + Intronic
1128474483 15:67985406-67985428 AGCAAGGAGTACAGAGCAAAGGG + Intergenic
1128508620 15:68299440-68299462 AAGAAGGAGTGCAGGATAAAAGG + Intronic
1129206041 15:74037532-74037554 AACAAGGAGAGCAGAGGAAGGGG - Intronic
1129445297 15:75613021-75613043 AACAAGGAGGGCAGATCATGAGG + Intronic
1130820637 15:87491471-87491493 AGCAAGAAGTGCAGAGTGAAGGG - Intergenic
1131131129 15:89901175-89901197 AACACAGAGTGCTGAGGAAGGGG + Exonic
1133819181 16:9221513-9221535 AACAAGGATTTCAGTGCAAGTGG - Intergenic
1135013250 16:18902789-18902811 AAATATGAGTGCAGAGTAAGAGG - Intronic
1135320185 16:21490386-21490408 AAATATGAGTGCAGAGTAAGAGG - Intergenic
1135373020 16:21921876-21921898 AAATATGAGTGCAGAGTAAGAGG - Intergenic
1135438769 16:22448826-22448848 AAATATGAGTGCAGAGTAAGAGG + Intergenic
1136330409 16:29572084-29572106 AAATATGAGTGCAGAGTAAGAGG - Intergenic
1136354865 16:29737806-29737828 CAGAAGGAGTGCAGAGGGAGGGG + Intergenic
1136445038 16:30311803-30311825 AAATATGAATGCAGAGTAAGAGG - Intergenic
1139280517 16:65766436-65766458 ACAAAGGACTGTAGAGTAAGTGG - Intergenic
1139684535 16:68592581-68592603 AAAAAGTAGAGCAGGGTAAGGGG - Intergenic
1140891236 16:79287101-79287123 AAAAAGGAAGGCAGAGTACGTGG - Intergenic
1142610442 17:1106873-1106895 CACAAGGCGTTCAGAGCAAGGGG - Intronic
1143015204 17:3887876-3887898 AACAAGGCATGCGGAGTGAGGGG - Intronic
1145369943 17:22299786-22299808 AACAAGGGAGACAGAGTAAGAGG - Intergenic
1145840323 17:27988998-27989020 AGGAAGGAGTGGAGAGAAAGGGG + Intergenic
1146116596 17:30146199-30146221 AAAAAGAAGTGTAGAGTAGGGGG - Intronic
1147053101 17:37812679-37812701 AACAAGGTGTGGACAGGAAGAGG + Intergenic
1147981937 17:44280168-44280190 AGCCAGGAGTGCAGGGTCAGGGG - Intergenic
1148652237 17:49258648-49258670 AACAAGGAGAGAAAAATAAGGGG - Intergenic
1150590568 17:66558669-66558691 TAGGAGGAGTGGAGAGTAAGGGG + Intronic
1150908213 17:69361302-69361324 AACAAGCAGGGCAGAGGAAGTGG + Intergenic
1150977608 17:70106409-70106431 CACAAGGAGCACAGAGTAAATGG + Intronic
1152049848 17:77964800-77964822 AATATGAAGTGCAGAGTGAGGGG + Intergenic
1154217819 18:12428434-12428456 AAAAAGGAGGGAAGAGAAAGAGG - Intronic
1155703347 18:28777782-28777804 TAAAAGGAGAGCAGAATAAGGGG - Intergenic
1155825072 18:30431161-30431183 AACCAGGACTACAGAGGAAGGGG - Intergenic
1156828787 18:41466025-41466047 AACAAGCAGTGCAGAGATGGAGG - Intergenic
1156883514 18:42108124-42108146 AACAAGGAGGAGGGAGTAAGAGG + Intergenic
1158070835 18:53468770-53468792 AACAAGGGGTGTGTAGTAAGTGG - Intronic
1158745918 18:60199936-60199958 AATAAGGAATGCAAAATAAGAGG - Intergenic
1159470212 18:68842991-68843013 AACAAGGCTTGCAGATGAAGCGG - Intronic
1159755670 18:72361045-72361067 AACAGGAAGTGCCGAGTAAAAGG + Intergenic
1160009082 18:75090010-75090032 AACAGGGAGAGCACAGTCAGAGG + Intergenic
1160180179 18:76627571-76627593 AAGAAGGAGTAAAGAGAAAGAGG + Intergenic
1160383224 18:78476453-78476475 AGCAAGAAGTGCAGAGTGAAAGG - Intergenic
1160409701 18:78667522-78667544 AACATGGAGTGGAGAGCAAGAGG + Intergenic
1161327184 19:3669560-3669582 AGCAAAGAGTGCAGAGAAGGCGG + Intronic
1164144442 19:22503207-22503229 AAGATGGAGTTCAGAGCAAGAGG - Intronic
1164159909 19:22619686-22619708 AAGAAACAGTGAAGAGTAAGAGG - Intergenic
1168481470 19:56723849-56723871 CACCAGGAGTGAGGAGTAAGGGG + Intergenic
1202685175 1_KI270712v1_random:42925-42947 AGAAAGGAGTGCAGAGTAAGAGG - Intergenic
924974860 2:163119-163141 AAAAAGGAGTCCAGAGGAACGGG - Intergenic
925096304 2:1206954-1206976 AACAAGGGGTACAGAGTATGTGG + Intronic
925474137 2:4193644-4193666 AGCAAGAAGTGCAGAGTGAAGGG + Intergenic
926776211 2:16425706-16425728 AACAAGGAGTGAGTAGTAAACGG + Intergenic
927151808 2:20200547-20200569 AACAAGGAGTGCTGGGCAGGAGG + Intergenic
927904345 2:26846757-26846779 GAGAAGGAGTGCAGACTCAGGGG + Intergenic
927908613 2:26880501-26880523 AATCAGGGGTGCAGAGCAAGAGG - Intronic
928414827 2:31083474-31083496 AACAAGGAGGGAAGAGGAGGAGG + Intronic
928547839 2:32344546-32344568 GAGAAGCAGTGCAGAGGAAGGGG - Intergenic
928809242 2:35202107-35202129 AACTAGCAGTGAAGAGTAACTGG + Intergenic
928957573 2:36886708-36886730 AAAAGGGGGTGAAGAGTAAGTGG - Exonic
928960667 2:36922811-36922833 AGAAAGGAGTGCAGAGTAAGAGG - Intronic
929436692 2:41934076-41934098 AAGCAGGAGTGCTGAGTCAGTGG - Intergenic
929826592 2:45313684-45313706 AACAAGGAGGGGAGAGTAGAAGG + Intergenic
930909578 2:56615653-56615675 AACATGAAGTGAAGAGGAAGTGG + Intergenic
931506928 2:62939203-62939225 AAAAAGTAGAGCAGGGTAAGTGG + Intronic
934246546 2:90311930-90311952 AGAAAGGAGTGCAGAGTAAGAGG + Intergenic
936095795 2:109529309-109529331 AGCCAGGAGTGCAGAGGAGGAGG + Intergenic
936342154 2:111643229-111643251 AACCAGGAATGCAGAGGATGGGG + Intergenic
937172731 2:119892649-119892671 AACAAGGAGAGGAGAGTATTAGG + Intronic
938542152 2:132292330-132292352 AACAAGGAGTAAATAGCAAGGGG - Intergenic
938708427 2:133954210-133954232 AACATGGACTCCAGAGTAACGGG + Intergenic
940339840 2:152568691-152568713 AACAAGAAGTGCTGAGCAAAGGG + Intronic
941007992 2:160267034-160267056 AACATGAAGTGCTCAGTAAGTGG + Intronic
942121844 2:172785801-172785823 AAGAAGAAGTGGAGAGAAAGGGG - Intronic
942652750 2:178185799-178185821 AACAAGTATTGCAGAGGACGTGG + Intergenic
942811201 2:180003207-180003229 AACATGGAGTGAAGACTAATAGG - Intronic
942977212 2:182032363-182032385 AACCAGTAGTGCAGAGTAATGGG - Intronic
943633995 2:190285387-190285409 AAAAAGTACTGCAGAGTAAGAGG - Intronic
944003970 2:194878801-194878823 AACAATGAGAGCAGAGTAAAGGG - Intergenic
944235885 2:197441100-197441122 TACAAGGAGGGCAGATTATGAGG + Intergenic
944613550 2:201436179-201436201 AATGAGGAATGCAGAGTAAATGG + Intronic
948936830 2:241171022-241171044 AATAAGGAGTCCAGAGACAGAGG + Intronic
1168856016 20:1009626-1009648 AAGAAGAAGTCCAGAGGAAGAGG - Intergenic
1170016016 20:11783122-11783144 AAAAGGGAGTGGAGAGTGAGGGG + Intergenic
1171871038 20:30525204-30525226 AACAAGGAGTAAATAGCAAGGGG - Intergenic
1173738620 20:45379926-45379948 AACAGGGAGGGCAGAGGTAGAGG + Intronic
1173869488 20:46332544-46332566 AACAAGGACTGCATGCTAAGTGG + Intergenic
1174573224 20:51518535-51518557 AAAAAGGACTGCAGGGTAAGAGG - Intronic
1176146593 20:63568245-63568267 TACAGGGAGTGCAGAATCAGAGG + Intronic
1177598287 21:23275623-23275645 AAGAAGGAGTGCTGAGTGAAGGG - Intergenic
1178179110 21:30139442-30139464 ACAAAGGAAGGCAGAGTAAGCGG + Intergenic
1178773702 21:35528972-35528994 AACAAGCAGGGCAGAGGCAGGGG - Intronic
1179904573 21:44415760-44415782 AACAAGGAGTACAAAATAGGTGG + Intronic
1181956657 22:26592223-26592245 AAAATGGAGTTCAGAGGAAGAGG + Intronic
1183009036 22:34929692-34929714 AATAAGGAGTCCAGAGTTGGTGG - Intergenic
1183152706 22:36050581-36050603 AAAAAATAGAGCAGAGTAAGAGG + Intergenic
1183192652 22:36331651-36331673 AACAGGAAGTACAGAGGAAGGGG + Intronic
949214772 3:1552533-1552555 AAGTAGGAGTGCAGAGAAAGAGG + Intergenic
949229245 3:1730917-1730939 AAGAAGTCGTGCAGAGTAAGGGG - Intergenic
950115473 3:10447974-10447996 AACCAGGAGAGCAGACAAAGAGG + Intronic
950378518 3:12591635-12591657 TACAAGGACTGTAGAGTTAGTGG - Intronic
951486614 3:23219681-23219703 CACAAAGGGAGCAGAGTAAGGGG - Intronic
951678434 3:25268595-25268617 AACAAGGAAGGCAGAGTGAGTGG - Intronic
952570218 3:34706737-34706759 AATAAGAAGTGCAGATTAGGAGG - Intergenic
954239092 3:49279473-49279495 AACTAGGAGTCCAGAGTCTGTGG + Intronic
955762149 3:62298227-62298249 AACAATGTGTGAAGAGTATGTGG + Intergenic
956084167 3:65591948-65591970 AAAAAGCAGAGCAGAGTAAGGGG - Intronic
958090307 3:88869265-88869287 AAGAAGAAGTGCAGAGCAAAAGG + Intergenic
959055317 3:101561984-101562006 TACCAGGAGTGCAGAGATAGTGG - Exonic
959289689 3:104458009-104458031 ATCAAGGAGTGAAAAGAAAGTGG - Intergenic
959306613 3:104674725-104674747 AACAAGCAATGCATAGTAGGAGG - Intergenic
961220380 3:125194516-125194538 AGCAAGCAGAGCTGAGTAAGAGG + Intronic
961869718 3:129978382-129978404 AACAAGGAGGGCAGAGGACCAGG + Intergenic
961946085 3:130690369-130690391 AAAAAGAAGTGCAATGTAAGAGG + Intronic
962378009 3:134874857-134874879 AGCAATGACTGCAGAGAAAGAGG - Intronic
962443908 3:135448359-135448381 GACACAGCGTGCAGAGTAAGAGG + Intergenic
963260278 3:143185415-143185437 AAAAAGGAGTGCAGTGTATCAGG + Intergenic
963802479 3:149689950-149689972 CACAAGGAGTTAAAAGTAAGAGG + Intronic
963990745 3:151650509-151650531 AACAATGAGTGAAGTGCAAGTGG - Intergenic
964954164 3:162331966-162331988 AAAAAGGATTCCAGAGAAAGAGG - Intergenic
965031193 3:163370177-163370199 AGCAAGAACTGCAGAATAAGTGG + Intergenic
965430601 3:168582932-168582954 ATGAAGGAGTGCAGGGGAAGTGG - Intergenic
967586789 3:191222892-191222914 AGCAAGAAGTGCAGAGCAAAAGG - Intronic
967979725 3:195058601-195058623 AAACAGGAGGGCAGAGTGAGTGG - Intergenic
969686564 4:8678271-8678293 AAACAGGAGTGGAGAGTCAGTGG + Intergenic
969862634 4:10049754-10049776 AACCAGAAGTGCAGTGCAAGAGG + Intronic
970137020 4:12936452-12936474 AAGAAGGAGGACTGAGTAAGAGG - Intergenic
972303900 4:37813100-37813122 GAAAAGGAGAGCAGAGAAAGTGG - Intergenic
972442283 4:39106355-39106377 AAAAAGTGGTGCAGAGTAAAAGG - Intronic
972662877 4:41133781-41133803 AACAAGGAGTGCAGAGTAAGGGG + Intronic
973195417 4:47434194-47434216 AAAAATGAGTAGAGAGTAAGGGG + Intergenic
973787759 4:54349422-54349444 AAAAAGGAGAGCAGAGAAACAGG + Intergenic
974021037 4:56692719-56692741 TCCAAGGACTGCAGAGCAAGGGG - Intergenic
974359371 4:60856428-60856450 AACTAGAAGTGCTGAGCAAGGGG - Intergenic
974714423 4:65648909-65648931 CAAAATGAGTGCAGAGAAAGAGG + Intronic
976042585 4:80905701-80905723 AAGAAGAAGTGCAGAGCAAAGGG + Intronic
976544350 4:86317354-86317376 ACTAAGGAGGGCAGAGTAATGGG - Intronic
976726882 4:88223476-88223498 AGCAAGAAGTGCAGAGTGAGGGG - Intronic
976960525 4:90966158-90966180 AAGAAGGAGTGAAGAGAAAGTGG + Intronic
977517973 4:98045950-98045972 AAGAAGGAGAGAAGAGAAAGAGG - Intronic
977798565 4:101198134-101198156 AACAAGGAGGGGAGAAAAAGAGG + Intronic
980094994 4:128480267-128480289 AAAACGTAGAGCAGAGTAAGAGG - Intergenic
981476890 4:145196305-145196327 CGCAAGAAGTGCAGAGTAGGTGG + Intergenic
982849968 4:160300912-160300934 AACAAGTATTGGAAAGTAAGTGG - Intergenic
983430432 4:167643117-167643139 AACAAACAAGGCAGAGTAAGGGG - Intergenic
984802746 4:183729752-183729774 AAGAAGGAGAGCAGGGTGAGTGG + Intergenic
985261417 4:188118276-188118298 AACAAGGACAGGAGAGGAAGAGG + Intergenic
985561648 5:590019-590041 AAGAAGAAGTGCAGAGTGAAGGG + Intergenic
985788480 5:1912324-1912346 AACAAGAAGTGCCGAGCAAAGGG - Intergenic
986752510 5:10801433-10801455 CACAAGGACTTTAGAGTAAGAGG - Intergenic
987501871 5:18721891-18721913 AAGAAGAAGTGCAGAGTGAGGGG - Intergenic
988247153 5:28701309-28701331 ATCAAGGAGTTGAGAGTAGGAGG + Intergenic
989461112 5:41699191-41699213 TACAGGGATTGAAGAGTAAGAGG - Intergenic
991405499 5:66297239-66297261 GACAAGGAGTTCAGGGGAAGAGG - Intergenic
992748701 5:79842716-79842738 TTCCAGGAGTGCAGAGGAAGCGG - Intergenic
994105800 5:95946918-95946940 AACAAGGAGTGGTGAGTACCTGG + Intronic
995061429 5:107815110-107815132 AATAAGGAAGGCAGAGAAAGTGG + Intergenic
995082268 5:108066082-108066104 AAGAAGGAGGGAAGAGTAAGTGG + Intronic
995137033 5:108690393-108690415 AACAAGAAGTACAGAGGAGGAGG - Intergenic
995821360 5:116236970-116236992 AAAAAGTAGAGCAGAGTAAAGGG + Intronic
996478386 5:123946965-123946987 AGCAAGGAATGCAGAGTGACTGG - Intergenic
998353757 5:141517643-141517665 TACAAGGTGTGTAGAGTATGTGG + Intronic
998373848 5:141678799-141678821 AAAAAATAGAGCAGAGTAAGAGG - Intronic
999466540 5:151811684-151811706 AAAAAGGGGGGAAGAGTAAGGGG + Exonic
1000094493 5:157959174-157959196 GACAAGGGGTGCAGAGTGATAGG + Intergenic
1000442658 5:161281978-161282000 AACAAGTAGAGCAGAGAATGAGG + Intergenic
1001357990 5:171050352-171050374 TACAAAGAGTGAAGAATAAGGGG - Intronic
1002425370 5:179171708-179171730 AAAAAGGTGGGCAGAGTATGGGG + Intronic
1003948701 6:11097999-11098021 AACATGGAGTTCAGATCAAGAGG + Intronic
1004031457 6:11874132-11874154 AACCAGGAGTGCTGAGGGAGGGG + Intergenic
1004755524 6:18606545-18606567 AAAAAGGAGTAGAGAGTAGGAGG + Intergenic
1005312192 6:24569562-24569584 CACCAGAAGTGCAGTGTAAGGGG - Intronic
1006377115 6:33677738-33677760 AACAAACAGGGCAGTGTAAGAGG - Intronic
1007782257 6:44261179-44261201 AAAAAGCAGAGCAGAGTGAGAGG - Intronic
1008279518 6:49579219-49579241 AAGAATGAGAGCAGAGTAAAGGG - Intergenic
1008658851 6:53644613-53644635 AACAAGAAGTGCTGAGCAAAAGG - Intergenic
1009394728 6:63186384-63186406 AAGGAGAAGTGCAGAGTAAAGGG - Intergenic
1011219976 6:85044046-85044068 AAAAAGGAGAGCAGGATAAGGGG - Intergenic
1011328162 6:86173570-86173592 AACAAGGTGAGCAGGGTAGGAGG - Intergenic
1011889201 6:92135674-92135696 AGCAAGAAGTGCAGAGCAAAGGG - Intergenic
1012864141 6:104597179-104597201 AACAAGGGGTGAAGATTGAGTGG + Intergenic
1013360759 6:109392095-109392117 AATAAGAAGTCCAGAGTAGGTGG + Intronic
1014270415 6:119330051-119330073 TACAGGATGTGCAGAGTAAGTGG - Intronic
1015480281 6:133700912-133700934 AAAAAGGAGAGCAGAGTAAGTGG - Intergenic
1016439536 6:144068808-144068830 GACAAGGTGGGCAGAATAAGAGG - Intergenic
1016686030 6:146883305-146883327 AAAAAGGAAGGAAGAGTAAGAGG + Intergenic
1019545866 7:1575858-1575880 AACAAGACGTGCAAAGCAAGTGG + Intergenic
1020438027 7:8186686-8186708 AACAAGGAGGGCAGGAAAAGGGG + Intronic
1020641689 7:10762528-10762550 AACAAGAAGTGCTGAGCAAAGGG - Intergenic
1022151039 7:27606710-27606732 AACAATCAGTGCAGAGTAAGAGG - Intronic
1022226158 7:28365553-28365575 ATGAAGGAGAGCAGAGAAAGGGG - Intronic
1024324124 7:48095459-48095481 GACCAGGAGTCCAGAGCAAGGGG - Intronic
1025301180 7:57820732-57820754 AACAGGGGACGCAGAGTAAGAGG - Intergenic
1027553222 7:79627818-79627840 AACAAGGGATGCAGAATATGGGG + Intergenic
1028002055 7:85511121-85511143 AAGAGGGAGAGCAAAGTAAGAGG + Intergenic
1028441002 7:90860868-90860890 AGGAAGGAGTGCAGTTTAAGAGG + Intronic
1028845728 7:95477857-95477879 AAAGAGGAGTGGAGAGAAAGGGG - Intergenic
1029353469 7:100032438-100032460 GGCAAAGAGTGGAGAGTAAGGGG - Intronic
1029814446 7:103078423-103078445 GAGAAGGAGTGCAGAGCAAAGGG - Intronic
1030287334 7:107840033-107840055 AAAGAGGAATGCAGAGTATGGGG + Intergenic
1030415340 7:109237179-109237201 AGGAAGAAGTGCCGAGTAAGGGG - Intergenic
1031025065 7:116671721-116671743 AACAAGGAGTTCATTGTTAGAGG - Intergenic
1032689661 7:134271517-134271539 AACTAGGAGGGGAGAGTAATGGG - Intergenic
1032702213 7:134392227-134392249 TACAACGAGTGCAGAGTAGATGG + Intergenic
1033224191 7:139547814-139547836 GACAAGGCGGGCAGATTAAGAGG - Intergenic
1033873870 7:145790791-145790813 AACCAGGAGCGCAGAGAAACAGG - Intergenic
1034563297 7:151895020-151895042 AACAAGGAGGGCAGAGGAGCGGG - Intergenic
1035233656 7:157482988-157483010 AACTAGGAGATCAGAGTCAGAGG - Intergenic
1035574587 8:696584-696606 AGGAAGGAGTGGAGGGTAAGAGG - Intronic
1036061256 8:5323873-5323895 AACAAGAAGTGCCTAGTAAAAGG + Intergenic
1038269285 8:26062180-26062202 AACAAAGAGTGCTGGGAAAGAGG - Intergenic
1039071249 8:33651058-33651080 AGCAAGAAGTGCAGAGTGAAGGG - Intergenic
1040549247 8:48425888-48425910 AACAAGTAGTGGAGAGGATGTGG + Intergenic
1040878751 8:52180800-52180822 AGAAAGGAGTACAGAGCAAGGGG + Intronic
1041405484 8:57494564-57494586 AAGAAGGAATGCAGAATAAAAGG + Intergenic
1042560934 8:70071640-70071662 AACTGGGAGCGGAGAGTAAGGGG - Intronic
1044201270 8:89440958-89440980 AGCAAGAAGTGCAGAGCAAAAGG - Intergenic
1044362604 8:91306156-91306178 AAAAAGGAGGGAAGAGTATGAGG - Intronic
1044608822 8:94072219-94072241 TACAAAGAGTGCAGAGGAACTGG - Intergenic
1044885517 8:96772633-96772655 AAGAAGGAGAGCAGAGTGAGAGG + Intronic
1046275866 8:111958856-111958878 AACAAGGAGGTCAGGGGAAGAGG + Intergenic
1046936119 8:119887371-119887393 GGAAAGGAGTGCAGGGTAAGGGG - Intronic
1046944647 8:119963238-119963260 CACAAGGATGGCTGAGTAAGAGG + Intronic
1047606719 8:126481956-126481978 CATAAGGAGTGCGGAGTTAGGGG - Intergenic
1047967457 8:130056845-130056867 AACAAGGAGAGCAGAAGAGGTGG + Intronic
1048434239 8:134400987-134401009 AACAAACAGTGAAGAGTAGGTGG + Intergenic
1048718178 8:137291836-137291858 AAAAGGGAGTAGAGAGTAAGGGG - Intergenic
1049632373 8:143665621-143665643 GACAAGGAGGGCAGGGTAAAGGG + Intergenic
1053147561 9:35722084-35722106 AACAAGGAGGGCAGTGAAAAGGG + Intronic
1053454954 9:38226882-38226904 ACGAAGGAGAACAGAGTAAGGGG + Intergenic
1056296867 9:85201929-85201951 AAGAAGAAGTGCTGAGTAAAAGG + Intergenic
1056501261 9:87212044-87212066 AACCAAAAGTGAAGAGTAAGAGG + Intergenic
1056817901 9:89815045-89815067 AACAAGGAAAGCAGGGAAAGCGG - Intergenic
1056914971 9:90738476-90738498 AAGAAGAAGTGCAGAGCAAAGGG - Intergenic
1057092068 9:92267273-92267295 AACAGGAAGGGCAGAGAAAGAGG - Intronic
1057416802 9:94870997-94871019 AAAAAGGAGTGGAAAGAAAGAGG - Intronic
1059889915 9:118789828-118789850 AATATGGAGTGAAGAATAAGAGG - Intergenic
1060454302 9:123776635-123776657 AACAATGATTGCTGATTAAGTGG - Intronic
1060612482 9:124980269-124980291 AGCAAGGAGTGCAAAGAAAAAGG - Intronic
1061862958 9:133477234-133477256 AACACGGACTGCAGGGGAAGGGG + Exonic
1061921615 9:133785567-133785589 AACAATCAGTCCAGAGTGAGAGG - Intronic
1186221750 X:7356485-7356507 AAGAAGCAGTGCAGAGCAAAGGG + Intergenic
1186851585 X:13585251-13585273 TAGAATGAGTGCAGACTAAGAGG - Intronic
1186985959 X:15013807-15013829 ATTAACTAGTGCAGAGTAAGTGG - Intergenic
1187143702 X:16618589-16618611 AACAAGTAGTGGAGAGGATGTGG - Intronic
1188302294 X:28519744-28519766 AACGAGAAGTGCAGAGTGAAGGG - Intergenic
1190506394 X:51130291-51130313 AAGCAGGAGTGCATACTAAGGGG + Intergenic
1190749827 X:53352277-53352299 GACAAGGAGTGTAGAGCAACAGG + Intergenic
1193892299 X:87064961-87064983 AAAAAGTAGTGAAAAGTAAGTGG + Intergenic
1195242102 X:102962001-102962023 AAGAAAGAGTGCAGATAAAGAGG + Intergenic
1195760403 X:108239754-108239776 AAGTAGGAGTGCACAGTAAAAGG - Intronic
1197151053 X:123220251-123220273 AACAGGGAGTGAAAAGAAAGGGG + Intronic
1199751394 X:150823024-150823046 AAGAAGAAGTGCAGAGTGAAGGG - Intronic
1199814289 X:151384173-151384195 AAAAAATAGAGCAGAGTAAGGGG - Intergenic
1200287664 X:154838985-154839007 AACTTGGAGACCAGAGTAAGGGG - Intronic
1201015731 Y:9599575-9599597 AAGAAGAAGTGCTGAGTAACAGG - Intergenic
1201968838 Y:19769300-19769322 ATTAAGGAGTGCTGAGAAAGTGG + Intergenic
1202588450 Y:26456684-26456706 AGAAAGGAGTTCAGAGTAAGAGG + Intergenic