ID: 972663265

View in Genome Browser
Species Human (GRCh38)
Location 4:41138479-41138501
Sequence GTCTGATATAAGCTCTTTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 115}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972663265_972663271 29 Left 972663265 4:41138479-41138501 CCAATAAAGAGCTTATATCAGAC 0: 1
1: 0
2: 0
3: 6
4: 115
Right 972663271 4:41138531-41138553 AATGGGCAAAGGATTTGAACAGG 0: 4
1: 56
2: 301
3: 754
4: 1478
972663265_972663269 18 Left 972663265 4:41138479-41138501 CCAATAAAGAGCTTATATCAGAC 0: 1
1: 0
2: 0
3: 6
4: 115
Right 972663269 4:41138520-41138542 CCCAATATAAAAATGGGCAAAGG 0: 2
1: 107
2: 513
3: 1753
4: 10832
972663265_972663267 12 Left 972663265 4:41138479-41138501 CCAATAAAGAGCTTATATCAGAC 0: 1
1: 0
2: 0
3: 6
4: 115
Right 972663267 4:41138514-41138536 AAACAACCCAATATAAAAATGGG 0: 4
1: 95
2: 598
3: 2320
4: 19939
972663265_972663266 11 Left 972663265 4:41138479-41138501 CCAATAAAGAGCTTATATCAGAC 0: 1
1: 0
2: 0
3: 6
4: 115
Right 972663266 4:41138513-41138535 GAAACAACCCAATATAAAAATGG 0: 2
1: 8
2: 146
3: 742
4: 3169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972663265 Original CRISPR GTCTGATATAAGCTCTTTAT TGG (reversed) Intronic
908145504 1:61237010-61237032 GTCTAATATAAGCTCCTGAAGGG + Intronic
910690720 1:89962956-89962978 TTCTGATGTAATCTATTTATTGG - Intergenic
915408312 1:155679623-155679645 TTCTGATGTAGGCTCTTTCTGGG - Intronic
918605022 1:186414473-186414495 ATCTGATATAAGGATTTTATTGG + Intronic
921197920 1:212778249-212778271 CTCAGACATAAGCTCTTTATGGG + Intronic
924263880 1:242260494-242260516 GTCTGATACATGATCTTAATCGG - Intronic
1062771925 10:108333-108355 GTAAGACATAATCTCTTTATAGG + Intergenic
1064816024 10:19263546-19263568 GTTTGATATTAACTCCTTATTGG + Intronic
1066720919 10:38337970-38337992 GTCTGATACATGATCTTAATCGG + Intergenic
1069750038 10:70739325-70739347 CACTGATCTAAGCTCTTTGTTGG + Intronic
1070508243 10:77136272-77136294 GTCTGATACATCTTCTTTATAGG + Intronic
1072479817 10:95800016-95800038 GTCAGATATTAGATCTTTGTTGG + Intronic
1073784922 10:106878517-106878539 GTCTGGCAAAGGCTCTTTATGGG - Intronic
1074220748 10:111435374-111435396 CTGTGATCTAAGCTCTTTATGGG - Intergenic
1074948937 10:118309445-118309467 GTCTGATATAAACTTTCTCTGGG - Exonic
1079358399 11:19749551-19749573 GTCTGAATTAAGCTCCTTATGGG + Intronic
1079838004 11:25358943-25358965 ATATGATATAATCTCTTAATGGG + Intergenic
1082743046 11:56932247-56932269 TACTGATATATGCCCTTTATGGG + Intergenic
1086726570 11:90192783-90192805 TTCTGATATACAGTCTTTATAGG - Exonic
1087478966 11:98675223-98675245 TTCTGATATTAGATCTTTGTTGG + Intergenic
1093299226 12:17433276-17433298 CTATGATATAGGCACTTTATGGG + Intergenic
1094057076 12:26278652-26278674 TTAGGATATAAGCTCTTTAAAGG - Intronic
1098827741 12:75318797-75318819 TTAGGATATAAGCTCTTTAGAGG + Intronic
1099141794 12:78987016-78987038 TTCAGATATAAGCCCTTTATTGG - Intronic
1100092554 12:90988462-90988484 GTCAGATATAATCTCTTTACTGG - Intronic
1110386765 13:74921330-74921352 GTCTCATGTAAACACTTTATTGG + Intergenic
1111681006 13:91441301-91441323 GTCTGATAACACCTCTTTAATGG - Intronic
1114950307 14:27742686-27742708 GACTACTATAAGCTCTTTCTTGG + Intergenic
1116428066 14:44814311-44814333 ATGTGAGATAAGCTCTTTAGAGG - Intergenic
1118673841 14:68161128-68161150 GTTTGAGATAGGCACTTTATAGG + Intronic
1118722356 14:68603530-68603552 GTCTGTTCTCAGCTCTTTTTTGG + Intronic
1121368844 14:93338534-93338556 GCTGGATATAAGCTCTTTTTTGG - Intronic
1129899508 15:79135548-79135570 TTCTGAAATAAGCTCTTTTGGGG - Intergenic
1131983153 15:98015783-98015805 TTTTGAAATTAGCTCTTTATTGG + Intergenic
1134640659 16:15827186-15827208 CTCTGATTTAAGTTCTTTAAGGG - Intronic
1136527147 16:30838809-30838831 GTCTGATATAATCTATTTGGGGG - Intronic
1144447775 17:15346873-15346895 GTCTGAAATAAGCTAGATATGGG - Intergenic
1144897893 17:18556474-18556496 GTCTGATATTTGCAATTTATAGG - Intergenic
1145134480 17:20389240-20389262 GTCTGATATTTGCAATTTATAGG + Intergenic
1153965872 18:10181783-10181805 CTCTGATGTGAGCTGTTTATGGG + Intergenic
1155361439 18:25007066-25007088 GTCTGAGATAAGTTTTTGATAGG - Intergenic
1155702036 18:28757911-28757933 GTCTGATTTAAGTCCTTTACAGG - Intergenic
1156064565 18:33124448-33124470 GTATGGTATCAGCTATTTATTGG - Intronic
1157532312 18:48431305-48431327 GTCGTATATAAGCTCTTTGAGGG + Intergenic
1160007402 18:75077343-75077365 GGCTGATTGAAGCTCTTTGTGGG - Intergenic
927956293 2:27209827-27209849 GTCTGATTTTCCCTCTTTATTGG - Intronic
931022063 2:58057216-58057238 GTCTCATACAACCTATTTATTGG - Intronic
932083458 2:68736726-68736748 GTCTGATATAGGTTATCTATGGG - Intronic
933196908 2:79401180-79401202 GTATGAAATAAGCACATTATGGG - Intronic
936960110 2:118064205-118064227 ATCTGGTCTAAGCTCTTCATGGG + Intergenic
942277058 2:174331072-174331094 GTCAGATAAATGCTTTTTATAGG + Intergenic
944877845 2:203981123-203981145 GTCTGAGATGATCTCTTTAAGGG + Intergenic
945757794 2:213870845-213870867 GAATGCTATAAGCTCTTTAAGGG + Intronic
946547201 2:220757123-220757145 GTTTAATATAAACTCTTGATAGG - Intergenic
1169867140 20:10214247-10214269 TTCTTATTTAAGCTGTTTATTGG + Intergenic
1185124138 22:48995751-48995773 TTTTGATATAAGGTCTTTTTTGG + Intergenic
949549217 3:5098280-5098302 ATTTGAAATAAGGTCTTTATAGG + Intergenic
950877087 3:16285878-16285900 TTCTGAAATTAGCTCTTTGTGGG + Intronic
951164308 3:19466588-19466610 GTATGTTATAATCTCTTTGTTGG - Intronic
952694322 3:36248261-36248283 GTTTGTTCTCAGCTCTTTATAGG - Intergenic
954576589 3:51679707-51679729 GTCAGATATCAGCTGTTTTTAGG + Intronic
958758697 3:98280925-98280947 TTCTGATATTAGACCTTTATTGG - Intergenic
962722904 3:138192938-138192960 GTGTTTTAAAAGCTCTTTATAGG + Intronic
963337082 3:143987716-143987738 GTCTTATATATACTTTTTATAGG - Intronic
966427834 3:179799322-179799344 GTCAGATCTAAGATTTTTATAGG - Exonic
969978139 4:11126020-11126042 GTCTCTTATGAGCTCTCTATTGG + Intergenic
972663265 4:41138479-41138501 GTCTGATATAAGCTCTTTATTGG - Intronic
974242149 4:59263599-59263621 GTCTGATACAACCTCAATATGGG + Intergenic
975899545 4:79135659-79135681 ATCTGATACAGGCCCTTTATTGG + Intergenic
975927824 4:79480062-79480084 GGCTAATATATGCTTTTTATTGG + Intergenic
976356327 4:84121847-84121869 GTTTGCTATAAGCTAATTATAGG - Intergenic
976908505 4:90270090-90270112 GACTGGTATTAGCTCTTTAAAGG - Intronic
977698973 4:99999787-99999809 CTTTGATATAAGCTCTACATTGG - Intergenic
978469590 4:109049148-109049170 ATCTGCTATCAGCTCTTGATAGG + Intronic
978768234 4:112427095-112427117 GACTGATATGAGCTCTTCCTTGG + Intronic
984036404 4:174673535-174673557 GTCTAATATATTCTGTTTATGGG + Intronic
984265442 4:177493233-177493255 GATTGATATAAGCACTTCATGGG - Intergenic
991655125 5:68896288-68896310 CTCTGTAATAAGCTCCTTATTGG + Intergenic
992196111 5:74340559-74340581 GTCAAATAAAAGCTCTTTCTTGG - Intergenic
992203484 5:74406828-74406850 CTCTGGTTTAAGCTCTTTAGAGG - Intergenic
995103001 5:108338468-108338490 GTCTGTTACCAGATCTTTATTGG - Intronic
999579675 5:153022868-153022890 GTCTGATATAAGTTATTTTTTGG - Intergenic
1007551851 6:42735934-42735956 GTCTAAAATAGGCTCTTTAGGGG + Intergenic
1009719331 6:67446039-67446061 TTCTTATATAAGCTTTTGATTGG + Intergenic
1010941688 6:81926536-81926558 GTCTGTTATGAGCCCTGTATTGG + Intergenic
1011408343 6:87039419-87039441 TTATTATATGAGCTCTTTATAGG - Intergenic
1011762146 6:90578708-90578730 TTCTGATATTAGCTCTCTAAGGG + Intronic
1012728191 6:102843744-102843766 GTCTTATATAATGTCATTATAGG + Intergenic
1014804234 6:125811478-125811500 ATATGAAATAAGCTCTTTAGGGG + Intronic
1016641194 6:146351479-146351501 GTTAGATATAAGCTCCATATTGG - Intronic
1016985855 6:149895338-149895360 GTCTGCTATAAGCCCCTGATTGG + Intronic
1018712878 6:166509258-166509280 GTCTGTTTAAAGCTCTTTGTAGG + Intronic
1020708591 7:11576766-11576788 GTATAATGTAAGCCCTTTATAGG - Intronic
1023450025 7:40273954-40273976 GTCTGCTAACAGCTTTTTATGGG + Intronic
1024902907 7:54342416-54342438 GTTTGATATAAGGTGTTTCTTGG - Intergenic
1027924350 7:84441210-84441232 GTCTGTTATAAGATCTTTTCAGG - Intronic
1030928480 7:115488326-115488348 GTCTGACATAAAATCTTTTTTGG + Intergenic
1031741449 7:125436910-125436932 ATCTGAAATAAGCACTTCATGGG + Intergenic
1032978034 7:137248340-137248362 GTCAGATATAAAATCTTTGTAGG - Intronic
1034568196 7:151932679-151932701 GTGTAATAAAAGCTCTTTACTGG + Intergenic
1035060575 7:156066407-156066429 GTCTGATACATGCTCCTAATGGG - Intergenic
1036143582 8:6230749-6230771 TTCTGATATGAGCCTTTTATAGG - Intergenic
1037391342 8:18395048-18395070 GACTGAAATAATCTTTTTATGGG - Intronic
1037427584 8:18772922-18772944 GTCCGATATTAACTCCTTATAGG + Intronic
1042107594 8:65345448-65345470 GTTTGATAGATGCTTTTTATCGG - Intergenic
1043127165 8:76413482-76413504 GTTTTATAGAAGCACTTTATCGG + Intergenic
1044674306 8:94714289-94714311 GTCTGGCCTAAGCTCTTTGTAGG + Intergenic
1045618756 8:103950640-103950662 GTTTGATACATGTTCTTTATTGG - Intronic
1045829196 8:106437706-106437728 CTCTTATATAATCTCTTTAATGG + Intronic
1046871761 8:119211568-119211590 GTCAGATATAAGCCATTTGTTGG + Intronic
1048826674 8:138434459-138434481 GGCTCATATAAGCAATTTATTGG + Intronic
1052097177 9:24397152-24397174 CACTGAGATAAGCACTTTATAGG + Intergenic
1055579107 9:77689407-77689429 GTCTAATATACCCTATTTATAGG - Intergenic
1061939752 9:133877585-133877607 GTCTGATGCAAGCTCTTAAAGGG + Intronic
1062403948 9:136385044-136385066 TTCAGATATAAGTCCTTTATCGG - Intronic
1185997204 X:4965108-4965130 GGCTGCTATAAACTTTTTATTGG - Intergenic
1186059001 X:5683429-5683451 GTGTGAGAACAGCTCTTTATAGG - Intergenic
1187145968 X:16637508-16637530 GTCTGATTTAAGATTTTTCTTGG - Intronic
1189917606 X:45872159-45872181 TTCTCACATATGCTCTTTATTGG + Intergenic
1193329759 X:80223075-80223097 GTCTGACATAAGATTTGTATGGG - Intergenic
1193444425 X:81582780-81582802 GTCTGATAAAAACAATTTATTGG + Intergenic
1199164717 X:144657732-144657754 GTATGATATAAACTTGTTATTGG - Intergenic