ID: 972663269

View in Genome Browser
Species Human (GRCh38)
Location 4:41138520-41138542
Sequence CCCAATATAAAAATGGGCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 13207
Summary {0: 2, 1: 107, 2: 513, 3: 1753, 4: 10832}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972663265_972663269 18 Left 972663265 4:41138479-41138501 CCAATAAAGAGCTTATATCAGAC 0: 1
1: 0
2: 0
3: 6
4: 115
Right 972663269 4:41138520-41138542 CCCAATATAAAAATGGGCAAAGG 0: 2
1: 107
2: 513
3: 1753
4: 10832

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972663269 Original CRISPR CCCAATATAAAAATGGGCAA AGG Intronic
Too many off-targets to display for this crispr