ID: 972663269 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:41138520-41138542 |
| Sequence | CCCAATATAAAAATGGGCAA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 13207 | |||
| Summary | {0: 2, 1: 107, 2: 513, 3: 1753, 4: 10832} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 972663265_972663269 | 18 | Left | 972663265 | 4:41138479-41138501 | CCAATAAAGAGCTTATATCAGAC | 0: 1 1: 0 2: 0 3: 6 4: 115 |
||
| Right | 972663269 | 4:41138520-41138542 | CCCAATATAAAAATGGGCAAAGG | 0: 2 1: 107 2: 513 3: 1753 4: 10832 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 972663269 | Original CRISPR | CCCAATATAAAAATGGGCAA AGG | Intronic | ||
| Too many off-targets to display for this crispr | |||||