ID: 972665442

View in Genome Browser
Species Human (GRCh38)
Location 4:41160650-41160672
Sequence GGTGAGAGGGAGACCAGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1076
Summary {0: 1, 1: 0, 2: 7, 3: 99, 4: 969}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972665442 Original CRISPR GGTGAGAGGGAGACCAGGGA AGG (reversed) Intronic
900122197 1:1053589-1053611 AGTGGGAGGGAGAAGAGGGATGG - Intronic
900212322 1:1462212-1462234 GGTGTCGGGGAGCCCAGGGAAGG - Intronic
900224992 1:1528831-1528853 GGGGTGGGGGAGCCCAGGGAAGG - Intronic
900345170 1:2207101-2207123 GGTGAGTGGGGGGCCAGTGAGGG + Intronic
900811149 1:4802181-4802203 GGAGAGATGGAGACAGGGGAGGG - Intergenic
901160230 1:7171761-7171783 TGTAGGAGGGGGACCAGGGAGGG - Intronic
901662106 1:10804912-10804934 GGGCAGAGGGACATCAGGGAAGG - Intergenic
901787104 1:11632009-11632031 GGGGAGAGGGAGGGGAGGGAGGG + Intergenic
902202202 1:14842073-14842095 AGTGAGAAAGAGAGCAGGGAGGG - Intronic
902282005 1:15381579-15381601 TGTCAGAAGGGGACCAGGGAGGG + Intronic
902560599 1:17274786-17274808 GGTGAGAGAGAGACAGGGAATGG + Exonic
902569858 1:17340411-17340433 GGAGAGAGGGTGGCCAGGGAAGG + Intronic
902605821 1:17568879-17568901 TGGGGGAGGGAGAGCAGGGAGGG - Intronic
902629874 1:17698380-17698402 GGTCAGAGGGAGGACAGGGTGGG + Intergenic
902705206 1:18199678-18199700 GGAGGGAGGGAGACCAGGGAAGG - Intronic
902708925 1:18225646-18225668 GGTGAGAGAGAGCCCAGGGGAGG + Intronic
902789859 1:18760377-18760399 TCTGAGAGGGAGGCCAGGGGAGG + Intergenic
902800052 1:18823752-18823774 GGTTACCGGGAGACCAGGTAGGG + Intergenic
902929541 1:19721159-19721181 AGTGAGGGGGAGGCCTGGGAGGG + Intronic
903147868 1:21387055-21387077 GGGGAGAGGGAGACGGGAGAGGG - Intergenic
903187974 1:21640045-21640067 GGTGGGAGGGGGGCCGGGGATGG - Intronic
903334648 1:22616835-22616857 TGTGACAGGGAGACCAAGAAAGG + Intergenic
903445861 1:23422851-23422873 AGTGAGGGGGAGGCCAGGGCAGG + Intronic
903576529 1:24342816-24342838 GGGGAGAAGGAGACCAGAGGTGG + Intronic
903730852 1:25494270-25494292 GGCCAGAGGAAGATCAGGGAAGG + Intronic
903847478 1:26287080-26287102 GGTGAGAGGAGGAACTGGGAAGG + Intronic
903907205 1:26695938-26695960 GGGGGGAGGGGGACCCGGGACGG - Intergenic
904533238 1:31182427-31182449 GGCGGGAGGGAGCCCAGGGTCGG - Intronic
904553863 1:31344535-31344557 GGAGGCAGGGAGACCAGTGAGGG + Intronic
905179092 1:36155821-36155843 GGGGAGAGGGGGAGCAGGGCTGG - Intronic
905217692 1:36421092-36421114 GGGGAGAGGCAGAACAGGGGAGG - Intronic
905341607 1:37282250-37282272 GGAGAGAAGGAGAAGAGGGAAGG + Intergenic
905587161 1:39129578-39129600 AGTCAGAGTAAGACCAGGGATGG + Intronic
905775974 1:40667354-40667376 GGTGGGATGGAGGCCAGGGCAGG + Intergenic
905869180 1:41393408-41393430 TGTGAGAGTGAGGCCAGGGCAGG + Intergenic
906199016 1:43947470-43947492 GGTGAGGGGGGGCCCAGGGCGGG - Exonic
907298589 1:53471115-53471137 GGTGAGAATTAAACCAGGGAAGG - Intergenic
907359944 1:53906305-53906327 GGGGACAGGGGGCCCAGGGAGGG + Intronic
907500141 1:54872968-54872990 GGTGTGAGGGACCCCTGGGATGG - Intronic
907640129 1:56180605-56180627 GGTGAGAGGAAGAGGTGGGAAGG - Intergenic
907815150 1:57911366-57911388 GTTGACAGGGAGATCTGGGAAGG + Intronic
908370037 1:63472494-63472516 CATCAGAGGGAGACCATGGAAGG - Intronic
908496518 1:64700074-64700096 GGAGAGAGGAAGGCCAGGCATGG - Intergenic
908554932 1:65248389-65248411 GGAGAGTGGGAGACCCTGGAAGG + Intronic
909120608 1:71598564-71598586 GGAGAGAGTGTGAGCAGGGAAGG - Intronic
909603761 1:77488009-77488031 TTAGAGAGGGTGACCAGGGAAGG + Intronic
909700071 1:78512463-78512485 GGTGAGAGAGGGAGCAGGAAAGG + Intronic
909837659 1:80276894-80276916 GGAGAGAGGGAGCCCACAGATGG - Intergenic
909907786 1:81220898-81220920 TGTGGGAGGGAGGCCAGGGGTGG + Intergenic
912308510 1:108595562-108595584 GGAGAGAGGGAGGAAAGGGAGGG + Intronic
912714919 1:111976352-111976374 GGAGATAGGGAGGCCAGGCAGGG - Intronic
912765131 1:112402126-112402148 GGTGAGAGCCAGGCCAGGCATGG + Intronic
912802652 1:112730183-112730205 GGGGTGAGGGAGGTCAGGGAAGG - Intergenic
913280625 1:117181758-117181780 GCTGAGAGGAAGAACAGGGCAGG + Intronic
914348890 1:146822647-146822669 GGGGAGAGAGACAGCAGGGAGGG - Intergenic
914875656 1:151511368-151511390 GGTGGGAGGGAGAGAAAGGAGGG + Intronic
915091346 1:153428529-153428551 GGTGAGAGGCAGCCCTGAGAAGG + Intergenic
915093766 1:153444759-153444781 GGTGAGAGGCAGCCCTGAGATGG - Intergenic
915243663 1:154541551-154541573 GGAGAGAGGGAGACCAGCATGGG + Intronic
915278147 1:154803878-154803900 GGTGAGTGGGAAAGGAGGGAGGG - Intronic
915347094 1:155203064-155203086 GGTGAGTGGGAGAGCAGGGGAGG - Exonic
915472853 1:156136189-156136211 GGGGAGAGGGAGACCAAGTGGGG - Intronic
915492468 1:156258848-156258870 GCTGGGAGGGAGGCCTGGGAAGG - Intronic
915597775 1:156905242-156905264 GGCCAGGGGGAGGCCAGGGAAGG - Intronic
915625321 1:157110884-157110906 GGGCTGAGGGAGGCCAGGGAGGG + Intergenic
915826771 1:159086435-159086457 GGGCAGAGGGAGGCCAGGAAGGG - Intronic
915832506 1:159144221-159144243 GGTGAGAGGAAGATGAAGGAAGG - Intronic
916048401 1:161018001-161018023 GGAGAGAGGGAAACCTGGGTTGG - Intronic
916702185 1:167308544-167308566 GGACAGAGTGAGACCAGGGAAGG - Intronic
916705554 1:167345654-167345676 GTTGAGAGGCAGAACAGAGATGG + Intronic
917341726 1:173986524-173986546 GGAGAGAGGGAGGCCAAGGTGGG - Intronic
917389781 1:174522551-174522573 GAGGGGAGGGAGACGAGGGAAGG + Intronic
917961654 1:180150528-180150550 GGTGACCTGGGGACCAGGGAAGG + Intergenic
918127250 1:181595541-181595563 GGAGAGTGGGAGACCCGGGAAGG - Intronic
919762398 1:201106307-201106329 GGTGAGATGGGAAGCAGGGAAGG - Intronic
920231740 1:204475225-204475247 GGTGAGAGGGAGAGCAGGGCAGG - Intronic
921320208 1:213931288-213931310 GGACACAGGGAGACTAGGGAGGG - Intergenic
921646976 1:217630876-217630898 GGGGAGGGGGAGGTCAGGGAAGG - Intronic
922740286 1:228010580-228010602 CCTGAGAGGGAGAGCAGGGCTGG - Intronic
922740329 1:228010770-228010792 GATGTGAGGGAGACCCTGGAGGG - Intronic
922797909 1:228350225-228350247 GCTGAGAGTGATGCCAGGGAAGG - Intronic
923570624 1:235110319-235110341 AGTTAGAGGGAGAACAGGGGTGG - Exonic
923622206 1:235588273-235588295 CCTGAGAGGGAGGCCATGGAGGG - Intronic
923825249 1:237492896-237492918 GGAGGGAGGGAAAGCAGGGAGGG + Intronic
923841027 1:237670295-237670317 GGGGAGAGGGAGACTGGAGAGGG + Intronic
923852550 1:237813149-237813171 GGGGAGTGGGAGGCCAGGAAAGG + Intronic
923932466 1:238717784-238717806 AGTGAGAGGGAGAGGAAGGAAGG - Intergenic
924643934 1:245859646-245859668 GGCGAGCTGGAGACCAAGGAGGG + Intronic
1063092234 10:2875337-2875359 GGAGTAAGGGCGACCAGGGAAGG + Intergenic
1063132573 10:3191243-3191265 GGCGAGAGAGAGAGGAGGGATGG - Intergenic
1063365708 10:5488998-5489020 CGTGAGAGGGAAGCCAGGGGAGG + Intergenic
1063457094 10:6191546-6191568 GCTGAGAGGTAGAGCTGGGATGG + Intronic
1063779409 10:9304132-9304154 GGAGGGAGGGAGAGCAGGAAAGG - Intergenic
1063888229 10:10601305-10601327 AGTGGCAGGGAGAACAGGGATGG + Intergenic
1063917862 10:10902900-10902922 GGAGGGAGGGAGAAGAGGGAGGG + Intergenic
1064004182 10:11687353-11687375 GGTGAGACAGTGACCAGGGAGGG - Intergenic
1064868830 10:19914061-19914083 GGAGGGAGGGAGAGAAGGGAAGG + Intronic
1065332652 10:24618736-24618758 GTTGTGAGGCAGACCATGGAGGG + Intronic
1065917409 10:30365127-30365149 AGTGAGTGAGAGGCCAGGGAAGG - Intronic
1066371491 10:34821763-34821785 GGAGAGAGAGAGAAAAGGGAAGG + Intergenic
1066436451 10:35400331-35400353 GGGGAGGGGGAAAACAGGGAGGG - Intronic
1067581745 10:47450735-47450757 TGTGAGAGAGAGAGCAGGAAAGG - Intergenic
1067748766 10:48956419-48956441 GGTGAGAGAGAGACGTGGGCAGG - Intronic
1068800860 10:61138287-61138309 GGAGACAGGGAGACCAGAGAAGG + Intergenic
1069558544 10:69413676-69413698 GGACAGATGGAGACCAGGCAGGG + Intronic
1069596684 10:69676563-69676585 GGACAGAGGGAGACCAGGCTGGG - Intergenic
1069858218 10:71453433-71453455 GCTGAATGGGAGGCCAGGGAGGG + Intronic
1070148043 10:73788923-73788945 GGTAAGAGGAAGACAAGGGAGGG + Intronic
1070211993 10:74333855-74333877 GCAGAAAGGGACACCAGGGATGG + Intronic
1070258083 10:74827140-74827162 GGTGTGAGGAAGACTAGTGAGGG + Intronic
1070322843 10:75367255-75367277 GGTGAGAGAGAAGCCAGAGAGGG - Intergenic
1070548288 10:77470042-77470064 GGTGAGAAGGAGGCCAGGGTCGG + Intronic
1070827267 10:79398559-79398581 GATGGGAGGGAAACCTGGGAGGG + Intronic
1071779413 10:88826521-88826543 AGTGAGAGAGAGGCCAGGGCAGG - Intronic
1072024222 10:91438224-91438246 AGTGAGTGGGGGACTAGGGAAGG - Intronic
1072180135 10:92974548-92974570 GGGGAGAGGGAGACGGGAGAGGG - Intronic
1072186823 10:93047655-93047677 TGTGAGAGAGAGGCCAGGCACGG + Intronic
1072245737 10:93542420-93542442 GGTGGGAGGAAAACCAAGGAAGG + Intergenic
1072327462 10:94312560-94312582 GGTAAGGGAGAAACCAGGGAGGG - Intronic
1073073631 10:100809913-100809935 GGGGAGGTGGAGTCCAGGGAAGG + Intronic
1073186157 10:101616168-101616190 GGAGAGAGAGAGAGGAGGGAAGG + Intronic
1073217023 10:101842089-101842111 AGTGAGATTGAGACCTGGGAAGG - Intronic
1073222308 10:101885687-101885709 GGAGAGAAGGAGAGCAGAGATGG + Intronic
1073336603 10:102714607-102714629 GGTGAGAGGAGGACCTGGGCTGG - Exonic
1073491771 10:103857115-103857137 GATGAGAGGTAGACCTGGAACGG + Intergenic
1073649178 10:105340744-105340766 GGAGAGAGGCAGCACAGGGAAGG - Intergenic
1075672669 10:124273148-124273170 GGAGAGAGGGAGATGAGGGGTGG - Intergenic
1076208054 10:128618942-128618964 GGTGAGAGGGACCCCAGGTAAGG - Intergenic
1076296159 10:129386414-129386436 GGGGAGTGGGAGAGAAGGGAAGG + Intergenic
1076528900 10:131131264-131131286 GGTCAGAGGGATAGGAGGGAGGG + Intronic
1076551235 10:131279268-131279290 GGTGAGAGGGGGAGGAAGGAGGG + Intronic
1076687923 10:132206459-132206481 GGCCAGAGGGAGCCCCGGGAAGG - Intergenic
1076720482 10:132390173-132390195 GGTGAGTGGGAGGTCAGGGTCGG + Intergenic
1076737342 10:132464766-132464788 TCTGAGAGAGAGGCCAGGGAGGG - Intergenic
1076888262 10:133272335-133272357 GGTGGAAGGGAGAGCAGGGCTGG - Intronic
1077306250 11:1869915-1869937 GGTGTGGGGAAGACCAGGCAGGG - Intronic
1077332457 11:1989518-1989540 GGTGAGAGGGTGGACAGGGAAGG - Intergenic
1077514491 11:2993133-2993155 CATGAGAGGGAGAACAGGGCGGG - Intergenic
1077664824 11:4098376-4098398 GGGGAGAGGGAGGGGAGGGAGGG - Intronic
1077956325 11:7023831-7023853 CGAGAGAGGGAGAGTAGGGAGGG + Intronic
1078399290 11:11010092-11010114 GGTGATGGGGAATCCAGGGATGG + Intergenic
1078758360 11:14232577-14232599 GGTGAGATCCAGACCTGGGAGGG - Intronic
1079151178 11:17900901-17900923 GGAGAGAAGGGGACCAGGAATGG + Intronic
1079331220 11:19534498-19534520 GGTGAGAGAGAGAGAAGTGAAGG + Intronic
1079347619 11:19667004-19667026 GGTGGGAGGGAGGCTGGGGAGGG - Intronic
1079603365 11:22338367-22338389 AGTGAGAGTGAGAGAAGGGAGGG - Exonic
1079669340 11:23147485-23147507 AATGAGAGGGAGACATGGGAGGG - Intergenic
1079960582 11:26918370-26918392 GGAGGGAGGGAGAAAAGGGAAGG + Intergenic
1080405554 11:31975830-31975852 GGAGAGAAGGTGACCACGGAAGG - Intronic
1080812887 11:35723074-35723096 AGAGAGAGAGAGACGAGGGAGGG - Intronic
1081586121 11:44384951-44384973 AGTGAGTGGGAGGCCAGGGCAGG + Intergenic
1082001798 11:47397217-47397239 GGCCAGAGGGAGGCCAGGGAGGG - Intergenic
1082706037 11:56496522-56496544 AGGGAGAGGGAGACCGTGGAAGG - Intergenic
1082871168 11:57944618-57944640 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1082988086 11:59185023-59185045 GGAAAAAGGAAGACCAGGGAGGG + Intronic
1083162994 11:60867221-60867243 GGTGAGAGGGAGACAGTGGAGGG + Intergenic
1083631310 11:64096922-64096944 GGTGAGCGGGGGACCAGCAAGGG - Intronic
1083637089 11:64126638-64126660 GAGGAGGAGGAGACCAGGGAGGG + Intronic
1083763812 11:64832804-64832826 GGTGAGTGGGGGCCGAGGGAGGG - Exonic
1083904018 11:65658540-65658562 GTTGAGGGGGAGACCATGGAGGG - Intronic
1084040900 11:66542148-66542170 GGAGTGTGGGAGAGCAGGGAAGG + Intronic
1084210206 11:67617469-67617491 GGAGAGTGGGGGACTAGGGATGG - Intergenic
1084563611 11:69917664-69917686 GGAGAGAGGGAGAGGAGAGAGGG - Intergenic
1084804979 11:71572579-71572601 TGTGAGGGGGTGACCAGGGTGGG - Intergenic
1084874819 11:72123583-72123605 GGTTAGAGGGACACAAGGAAGGG - Intronic
1084962699 11:72725662-72725684 AATCAGAGGGAGAGCAGGGAGGG - Intronic
1085204565 11:74723050-74723072 GGAGGCAGGGAGACCAGGGAGGG + Intronic
1085313209 11:75528277-75528299 GGTGGGAGGGAAACCAGACATGG - Intergenic
1085473516 11:76773331-76773353 GGGGATAAGGAGCCCAGGGAGGG - Intergenic
1086001549 11:81990894-81990916 GCTGAGAGGGAGCCCACGGCTGG + Intergenic
1086570336 11:88276551-88276573 GGGGAGAGAGAGAGAAGGGATGG - Intergenic
1087801368 11:102508110-102508132 GGTGAGTGTGAGATCAGTGAAGG + Intergenic
1087841149 11:102922456-102922478 GGTGAGAGGTAGTGAAGGGATGG - Intergenic
1088108349 11:106230283-106230305 GGAGAGAGGGAGAAGAGGAAGGG - Intergenic
1088226858 11:107629964-107629986 GGTGAGGAGGACACTAGGGAGGG + Intronic
1088250464 11:107857364-107857386 GGAGAGAGGGAGGGAAGGGAGGG + Intronic
1088367197 11:109052255-109052277 CATGGGAGGGAGTCCAGGGATGG - Intergenic
1088718260 11:112569159-112569181 GGTGAGAGAGAAAGCAGGGTAGG + Intergenic
1088976142 11:114817960-114817982 GGAGAGGGGGAGAACAGGAAGGG + Intergenic
1089077930 11:115753542-115753564 AGGGAGAGTGAGGCCAGGGAAGG + Intergenic
1089358285 11:117870023-117870045 GGTGACAGCAAGACCTGGGAAGG - Intronic
1089674437 11:120080525-120080547 GGTGTGCTGGAGACCAGGGAGGG - Intergenic
1089965586 11:122652586-122652608 GGCCAGAGGGAGACCCAGGATGG - Intergenic
1090044231 11:123316879-123316901 GGGGAGAGGGAGGGGAGGGAGGG + Intergenic
1090203752 11:124873740-124873762 GCTGAGAGGGAGCCCCCGGAGGG - Exonic
1090277134 11:125428233-125428255 GGTGAGAAAGAGAGCAGGGCAGG - Intronic
1090663165 11:128895873-128895895 GGGTAGAAGGAGCCCAGGGAGGG + Intronic
1091131061 11:133147670-133147692 GGTGAGATGGGGAGCAGGGCGGG - Intronic
1091138271 11:133212448-133212470 GGTGAGGGGTTGACCAGGCATGG - Intronic
1091142815 11:133250507-133250529 GGAGAGAGGGAGGGAAGGGAGGG + Intronic
1091155555 11:133368278-133368300 AGGGAGAGGGAGAGGAGGGAAGG + Intronic
1091198213 11:133749910-133749932 GAGGAGAGGGAGAAGAGGGAGGG - Intergenic
1091236388 11:134025089-134025111 GGTGTGAGGGAGGCCAGAGCGGG - Intergenic
1202815438 11_KI270721v1_random:44694-44716 GGTGAGAGGGTGGACAGGGAAGG - Intergenic
1091399689 12:174501-174523 AGTGGGAGGGAGGCCAGGGGAGG + Intronic
1091647975 12:2288229-2288251 CTGGAGAGGGAGGCCAGGGAGGG - Intronic
1092082143 12:5725079-5725101 TGTGAGAGGGAGACAAGGAGAGG - Intronic
1094107811 12:26832668-26832690 GGTAAGCGGGAGACGAGGGCTGG - Exonic
1094415642 12:30212200-30212222 GGGGAGAGGGTGAGGAGGGAGGG + Intergenic
1094641911 12:32283997-32284019 GGGTAGAGGGAGGGCAGGGAAGG - Intronic
1095182024 12:39157305-39157327 GGAGACAGGGAGATCAGGGAAGG + Intergenic
1095454234 12:42365416-42365438 GGAGAAAGGGATACAAGGGAAGG - Intronic
1095947814 12:47763747-47763769 GATGGGAGGGAGAGGAGGGATGG + Intronic
1095962101 12:47842103-47842125 GGCCAGAGGGAGAGCTGGGAAGG + Intronic
1096039581 12:48501481-48501503 CATGAGAGGGAGACCGTGGAAGG + Intergenic
1096382752 12:51172860-51172882 AGAGAGAGCGAGACCTGGGAGGG - Exonic
1096400191 12:51299552-51299574 GGGGAGAAGGAGAACAGGAAGGG + Intronic
1096647924 12:53048285-53048307 GGGGAGTGTGAGACCAGTGAAGG + Intronic
1096678871 12:53241869-53241891 GGTGAAGGGGAGGACAGGGATGG - Intergenic
1096750958 12:53758574-53758596 GGAGGGAGTGAGGCCAGGGAGGG - Intergenic
1096816910 12:54207639-54207661 GGGGAGACCGAGCCCAGGGAGGG - Intergenic
1096974815 12:55693978-55694000 GGAGGGAGGGTGACCATGGAGGG + Intronic
1097177927 12:57154091-57154113 GGTGGGAGGGCGTCCAGAGAAGG + Intronic
1097744548 12:63286808-63286830 GGTGCCAGGGAGCCCAGGAAAGG + Intergenic
1100219495 12:92489155-92489177 GGTGACTGGGAGCCCAGGGAAGG - Intergenic
1101085111 12:101227671-101227693 GGTGTGAGGGAGCCCACTGAGGG - Intergenic
1101266399 12:103092904-103092926 GGGAAGAGGGAGACCCAGGATGG - Intergenic
1101623650 12:106416917-106416939 GGTGAAAGGGATATGAGGGAGGG - Intronic
1101654311 12:106706371-106706393 GGTGGGAGGGTGAGCAGGGCAGG + Intronic
1101759960 12:107650391-107650413 GGGGAGAGAGTGACCACGGAAGG - Intronic
1102186979 12:110956834-110956856 GGAGAGAGAGAGAACACGGAAGG - Intergenic
1102745210 12:115243892-115243914 GGGGAGAGGGAGGGAAGGGAAGG + Intergenic
1102976077 12:117207932-117207954 GGAGAGAGGAAGAGAAGGGAGGG - Intergenic
1103045225 12:117730501-117730523 AGGGAGAGGGAGACCGTGGAAGG - Intronic
1103087259 12:118071185-118071207 GGTGATAGGGTGTCCCGGGATGG + Intronic
1103188803 12:118982819-118982841 GGTGAGAGGGAGAGGAGGTTGGG + Intronic
1103274072 12:119697136-119697158 GGGGGCAGGGAGACCAGTGAGGG - Intronic
1103501675 12:121407903-121407925 GTGGAGAGGGGGACAAGGGATGG - Intronic
1103948580 12:124540214-124540236 GGTGGGAGGGAGGGCAGGGAGGG + Intronic
1104201035 12:126589256-126589278 GGTGAGAGTAAAACCATGGATGG - Intergenic
1104216514 12:126739202-126739224 GGTGACAGGAAGGCCAGGCAGGG + Intergenic
1104395626 12:128429957-128429979 GGGGAGAGGAGGACCAGGCATGG + Intronic
1104417454 12:128607081-128607103 GGTGAGAGGGTGATATGGGAGGG + Intronic
1104459339 12:128941880-128941902 AGAGAGAGAGAGACCAGGCACGG - Intronic
1104463649 12:128973648-128973670 GGTGAGAGGCAGAAAAGGGAGGG - Intronic
1104544975 12:129702490-129702512 GGGGAGAGGGTGCCCAGAGAGGG - Intronic
1104901894 12:132193908-132193930 GGTGAGGGAGGGAGCAGGGAGGG + Intergenic
1105007281 12:132729409-132729431 GGTGAGGGGGAGATGAGGGGAGG + Intronic
1105299618 13:19119818-19119840 GGTGAGCGGGAGAGTAGAGAAGG + Intergenic
1105319966 13:19310089-19310111 GGGGAGAGGGAAAGCGGGGATGG - Intergenic
1106055408 13:26232300-26232322 GGAGGGAGGAAGAACAGGGAAGG + Intergenic
1106549318 13:30757915-30757937 CTAAAGAGGGAGACCAGGGAGGG - Intronic
1106679976 13:31999488-31999510 GGGGAGAGGGAGACTGGAGAGGG - Intergenic
1107318523 13:39160706-39160728 GGAGAGAGGGAGAGGAAGGAAGG + Intergenic
1107446581 13:40474851-40474873 GGTGGGAGGAAGAACAAGGAAGG - Intergenic
1107988456 13:45796468-45796490 GATGAGAGTCAGATCAGGGACGG + Intronic
1107993761 13:45841172-45841194 TGTGACAGGGAGTCCAGGGCAGG - Intronic
1108074600 13:46666872-46666894 GGTGAGAGAGAGCCTTGGGAGGG + Intronic
1108127292 13:47258298-47258320 TGTGAGATGGAGACCCAGGAAGG - Intergenic
1108455714 13:50611820-50611842 TGTGACAGGGAGCCCATGGAAGG - Intronic
1108842980 13:54643239-54643261 GGAGAGAGGGAGGGGAGGGAAGG - Intergenic
1108942173 13:55969985-55970007 GGTGAGAGAGAGATGAGTGATGG + Intergenic
1110846498 13:80195801-80195823 GGTGAGAAGGAAAAAAGGGAAGG + Intergenic
1111293070 13:86193486-86193508 TGTGAGAGGGAGGCCAGGACTGG - Intergenic
1111860486 13:93698785-93698807 GGAGAGAGGGAAAAGAGGGAGGG - Intronic
1111929869 13:94502284-94502306 GATGAGGGGGACAGCAGGGAGGG - Intergenic
1112093254 13:96105280-96105302 GGAGGGAGGGAGAGAAGGGAAGG + Intronic
1112441424 13:99427107-99427129 GGTGGGAGGGAGGGCAGGGTGGG + Intergenic
1113010960 13:105765140-105765162 GGAGAGAGGGAGAGGAGGGGAGG - Intergenic
1113410933 13:110089158-110089180 GGTGGGAGGGGGATGAGGGATGG - Intergenic
1113576842 13:111401012-111401034 GCAGAGAGGGAGAGCAGGGATGG - Intergenic
1113696330 13:112348755-112348777 GGTGAGAGGGACAGAGGGGAAGG - Intergenic
1114050742 14:18918588-18918610 GGTGAGCGGGAGAGTAGAGAAGG - Intergenic
1114111816 14:19483334-19483356 GGTGAGCGGGAGAGTAGAGAAGG + Intergenic
1114387454 14:22269799-22269821 GGTAAGAGGTAAATCAGGGAAGG - Intergenic
1114497148 14:23140687-23140709 GGTGAGAGGTGGGCCAGGGCAGG - Intronic
1114534010 14:23411903-23411925 GGGGAGAGGGAGGGAAGGGATGG - Intergenic
1114617814 14:24077542-24077564 GGTGAGAGGAAGAGTAGGGGAGG - Intronic
1115117206 14:29895448-29895470 GGTGAGAGTGGGAACAGGGAGGG - Intronic
1115702301 14:35965873-35965895 TGTGGTAGGAAGACCAGGGAAGG + Intergenic
1115906981 14:38211199-38211221 GGCGAGAGGGGGACAGGGGAGGG - Exonic
1116676154 14:47908397-47908419 GGTGAGAGAGAGACAAGAGAGGG + Intergenic
1116840949 14:49820641-49820663 CATGAGAGGGAGACCGTGGAAGG - Intronic
1117537859 14:56719039-56719061 GGTGGGAGTGAGATCAGGGAAGG - Intronic
1117656922 14:57964787-57964809 GGTGAGAGGGGGCAGAGGGAGGG + Intronic
1117909565 14:60624093-60624115 AGTAAAAGGGAAACCAGGGAAGG + Intergenic
1118016339 14:61664913-61664935 GATATGAGGGAGCCCAGGGAGGG - Intergenic
1118647749 14:67856174-67856196 GGAGAGAGGAAGAGTAGGGATGG - Intronic
1118734579 14:68692146-68692168 GATGAGAGGGAGACTGGGGGCGG - Intronic
1119705358 14:76779684-76779706 TATGAGAGCGAGCCCAGGGAAGG + Exonic
1119847424 14:77840867-77840889 GGAGGGAGGGAGAGAAGGGAAGG + Intronic
1119902829 14:78275913-78275935 GGTAAGAGGTAGACGAAGGAGGG - Intronic
1120193934 14:81463191-81463213 AGGGAGAGGGAGACGGGGGAGGG + Intergenic
1120193942 14:81463210-81463232 AGGGAGAGGGAGACGGGGGAGGG + Intergenic
1120193950 14:81463229-81463251 AGGGAGAGGGAGACGGGGGAGGG + Intergenic
1120193958 14:81463248-81463270 AGGGAGAGGGAGACGGGGGAGGG + Intergenic
1120193966 14:81463267-81463289 AGGGAGAGGGAGACGGGGGAGGG + Intergenic
1120856401 14:89216522-89216544 GGAGAGTGGGATAGCAGGGAGGG - Intronic
1121038605 14:90726993-90727015 GGAAAGAGGGAGCCCAGGAAGGG + Intronic
1121282549 14:92709753-92709775 GGTGAGAGGCACATCAGGGCTGG + Exonic
1121630574 14:95418926-95418948 GAAGAGAGGGAGAAGAGGGAAGG - Intronic
1121818257 14:96944522-96944544 GCTCAGAGGGAGACCTGGAACGG - Intergenic
1121951576 14:98175394-98175416 GGTGAGAGGCAGACTCTGGAAGG + Intergenic
1121996404 14:98606865-98606887 GCTGGCAGGGAGGCCAGGGAAGG + Intergenic
1122156203 14:99751882-99751904 GGTGAGAAGGGAGCCAGGGAGGG + Intronic
1122270321 14:100566078-100566100 GGTGAGAGGGAGAGGAGGGCAGG + Intronic
1122283784 14:100639153-100639175 TGTGAGAGGCATTCCAGGGAAGG - Intergenic
1122324832 14:100875759-100875781 GCTGAGGGGTAGACCAGGAAGGG - Intergenic
1122470355 14:101962003-101962025 TGTGAGAGGGAGAGGAAGGATGG + Intergenic
1123070127 14:105638607-105638629 GGTGGTAGGGGGAGCAGGGAGGG - Intergenic
1123074717 14:105662269-105662291 GGTGGTAGGGGGAGCAGGGAGGG - Intergenic
1123179237 14:106452962-106452984 GGTGAGAGGGAGGACATGAAAGG + Intergenic
1124366452 15:29075119-29075141 GGGGAGAGGGAGTCCAGGTCAGG + Intronic
1124444317 15:29715751-29715773 GGGGAGTGTGAGATCAGGGAAGG - Intronic
1124850305 15:33330509-33330531 GGGGAGAGGAAGAGTAGGGAGGG - Intronic
1125414132 15:39434947-39434969 GGTGGGAGGGAGTCAAGGAAAGG - Intergenic
1125868324 15:43075998-43076020 CATCAGAGGGAGACCATGGAAGG - Intronic
1125943769 15:43696836-43696858 GTTCAGAGGGAGACTGGGGAAGG + Intronic
1126972115 15:54127555-54127577 GGGGAGTGGGGGACTAGGGAAGG + Intronic
1127150159 15:56066275-56066297 GGGGTGGGGGAGAGCAGGGAGGG - Intergenic
1127389820 15:58496484-58496506 GGAGAGAGGGAGAAAAGGAAGGG + Intronic
1127634750 15:60858562-60858584 GGTGGGAGGGACAGCGGGGATGG + Intronic
1128120202 15:65140408-65140430 GGAGAGAGGGTGAGCAAGGAGGG + Intergenic
1128155365 15:65388598-65388620 GGAGGCAGGGAGAGCAGGGATGG + Intronic
1128178072 15:65574529-65574551 AGTGAGAGGAAGACCACGCAAGG + Intronic
1128319822 15:66685297-66685319 CGTCAGAGTGAGCCCAGGGAAGG + Exonic
1128527482 15:68422355-68422377 GGTGTCTGGGAGACCAAGGACGG - Intronic
1128634792 15:69296246-69296268 GGTCAGAGGGAGTCCTGGCAAGG - Intergenic
1128693637 15:69744314-69744336 GGAGAGTGGGAGAGCAGGAAAGG + Intergenic
1128781217 15:70359923-70359945 GTGGAGAGGCAGACCAGGAAGGG - Intergenic
1129175341 15:73835940-73835962 GGAGTGGGGGAGCCCAGGGAGGG + Intergenic
1129429678 15:75490512-75490534 AGAGAGAGGGAGACCAGGCATGG + Intronic
1129665805 15:77578749-77578771 GGTGAGAGACAGATCAGTGAAGG - Intergenic
1129671424 15:77609980-77610002 TGTGAGGGGTAAACCAGGGAAGG + Intergenic
1129879047 15:78995217-78995239 TGTGAGAGGGAGGCCAGGCGTGG - Intronic
1129933039 15:79428231-79428253 GGAGGGAGGGAGAGGAGGGAGGG - Intergenic
1129933085 15:79428379-79428401 GGAGAGAGGGAGAGGAGGGAGGG - Intergenic
1130012909 15:80165808-80165830 AAGGAGAGTGAGACCAGGGAGGG + Intronic
1130020459 15:80226448-80226470 GGCCAGAGAGAGATCAGGGAGGG - Intergenic
1130395520 15:83497603-83497625 GGGGAGAGAGAGTCAAGGGAAGG - Intronic
1130980289 15:88807609-88807631 GGCGAGAGGAGGACCAGAGAGGG + Intronic
1131076569 15:89499106-89499128 GGAGGGAGGGAGACAAGGGCTGG + Intergenic
1131269040 15:90935422-90935444 GGGGAGAAGGAGGCCAGGGATGG - Intronic
1131366482 15:91846231-91846253 AGAGAGAGAGAGACAAGGGAGGG - Intergenic
1131479552 15:92769334-92769356 GGGGAGAGGGAGACGGGAGAGGG + Intronic
1131479579 15:92769422-92769444 GGGGAGAGGGAGACGGGAGAGGG + Intronic
1131608975 15:93940927-93940949 GGTGAGAGGGAGAGAAGGAAAGG + Intergenic
1132010294 15:98268971-98268993 GGTGGCAGGGAGGGCAGGGATGG + Intergenic
1132092528 15:98957752-98957774 AGAGAAAGGGAGAACAGGGAAGG - Exonic
1132291789 15:100708968-100708990 GGTGGGAGGAAAACCAGGCAGGG + Intergenic
1132321753 15:100930516-100930538 GGGGTGGGGGAGGCCAGGGAGGG - Intronic
1132383982 15:101387010-101387032 GGAGAGTGTGAGCCCAGGGAAGG - Intronic
1132698519 16:1212431-1212453 GGGCTGAGGGAGAGCAGGGAGGG + Intronic
1132721368 16:1317822-1317844 GTGGAGAGGAAGACCCGGGATGG + Intronic
1132814430 16:1818989-1819011 GGTGTGAGGGGGCCCAGGGGTGG - Intronic
1132855451 16:2042789-2042811 GTTGAGAGGGAGAAGAGGGGAGG - Intronic
1133591233 16:7246308-7246330 GGAGACAGGGAATCCAGGGAGGG - Intronic
1133964202 16:10519338-10519360 GGGGGGAGGGAGAGGAGGGAGGG - Intergenic
1133987989 16:10683111-10683133 GGTGAGAGGGTGGTCAGGGAAGG + Intronic
1134093892 16:11406151-11406173 GGTGAGAGGGAGCCAAGGGTTGG - Intronic
1134404581 16:13945230-13945252 GGGGAGAGGCAGAGGAGGGAAGG - Intronic
1134449419 16:14354270-14354292 GGTAGGAGGGAGGACAGGGAAGG + Intergenic
1134626171 16:15724434-15724456 GGTGAGAGGGGGACCATGAGTGG + Exonic
1134854475 16:17506824-17506846 GGGGAGAGGGAGAGGAGGGAGGG + Intergenic
1135277631 16:21127210-21127232 AGGCAGAGGGAGACCAGGCATGG + Intronic
1135574015 16:23571219-23571241 GGCGGGAGGGAGCCCAGGAAAGG - Exonic
1136128579 16:28203765-28203787 GTTGAGAGGAAGACCTGGTAAGG - Intronic
1136297485 16:29311961-29311983 GGTGTGAGGGGCTCCAGGGAGGG + Intergenic
1137328980 16:47471293-47471315 GGTGAGAGGAAGGCCTGGGATGG + Intronic
1137499253 16:48997821-48997843 GGAGAGAGGAAGAGCAGGGGCGG - Intergenic
1137825868 16:51494274-51494296 GGAGAGAGAGAGAGCAAGGAGGG - Intergenic
1138054135 16:53814687-53814709 GGTCACAGGGAGAGCTGGGATGG - Intronic
1138103641 16:54274808-54274830 GCTGTGGGGGAGACCAAGGAGGG - Intergenic
1138223600 16:55274035-55274057 GGTCAGATGGAGAGCTGGGAAGG - Intergenic
1138270280 16:55691145-55691167 GAGGAGAGGGAGATGAGGGAGGG + Intronic
1138434333 16:56988890-56988912 GGTAGGAGGGAGAGCAGGGAAGG - Intergenic
1138599869 16:58047913-58047935 GGTAGGAGGCAGACCTGGGAGGG - Intergenic
1138607466 16:58098218-58098240 GTTGAGTGGGAGTCCAGAGAGGG - Intergenic
1138633634 16:58319399-58319421 GGAGGCAGGGAGACCAGTGAGGG - Intronic
1138699493 16:58847020-58847042 CATGAGAGGGAGACCGTGGAGGG + Intergenic
1139004196 16:62551252-62551274 GGAGGGAGGGAGGGCAGGGAGGG - Intergenic
1139370011 16:66461177-66461199 GGGGACAGGGAGACCGGGGGTGG + Intronic
1139916781 16:70433290-70433312 GGGGACAGGGAGAGGAGGGAGGG - Intronic
1139949144 16:70660810-70660832 AATGAGAGGGATGCCAGGGATGG + Intergenic
1139985145 16:70892908-70892930 GGGGAGAGAGACAGCAGGGAGGG + Intronic
1141016935 16:80459522-80459544 GGTGGGTGGAGGACCAGGGAGGG + Intergenic
1141613979 16:85199848-85199870 GGTGGCTGGGAGAGCAGGGAGGG + Intergenic
1142059036 16:88018038-88018060 GGTGTGAGGGACCCCGGGGAGGG + Intronic
1142149475 16:88506263-88506285 GGGGGCAGGGAGACCAGGGCAGG + Intronic
1142183962 16:88685767-88685789 GGAGGGAGGGAGACCACGGGCGG + Intronic
1142196036 16:88739724-88739746 GGTAACAGGGAGATCAGGGCAGG + Intronic
1142500801 17:331930-331952 GGTGAGTGGAAAAGCAGGGAAGG + Intronic
1142759458 17:2034610-2034632 GGAGAGAGGGGGAGCAGGGGAGG - Intronic
1143305681 17:5944943-5944965 GATGAAAGGGTGACCTGGGATGG - Intronic
1143665769 17:8358722-8358744 GGAGAGAGAGAGAGAAGGGAGGG - Intergenic
1143882341 17:10039389-10039411 GATGAGGGTGGGACCAGGGACGG + Intronic
1144403448 17:14929289-14929311 GGTGAGAAGGAGACCCTGAAGGG + Intergenic
1144429138 17:15174423-15174445 GGAGACAGGGAGACCTGAGAAGG + Intergenic
1144535994 17:16092609-16092631 GGTGAAAGAGAGATGAGGGATGG - Intronic
1144752085 17:17655928-17655950 GGAGGGAGGGAGAGAAGGGAGGG + Intergenic
1144835034 17:18152184-18152206 GGTGAGAGGGCCAGGAGGGAGGG + Exonic
1146242165 17:31240201-31240223 GGGGAAGGGGAGACCGGGGATGG - Intronic
1146648884 17:34594031-34594053 AGATAGAGGGGGACCAGGGAGGG - Intronic
1146743558 17:35307315-35307337 GGTGAGAGAGAGACAAGGATTGG - Intergenic
1146943590 17:36859910-36859932 GGGGAGAGGGAGGCCAGGGAAGG + Intergenic
1147477525 17:40726866-40726888 GGAGAAAGCAAGACCAGGGAGGG - Intergenic
1147623308 17:41882767-41882789 GATGAAAGGGAGGCCAAGGAGGG - Intronic
1147689400 17:42306219-42306241 CCTGAGAGGGAGACAAGAGAGGG - Exonic
1147985793 17:44307472-44307494 GGTGTGAGTGAGTCCTGGGAGGG + Intergenic
1148048820 17:44759389-44759411 GGGGAGCGGGAGAGGAGGGAAGG + Intronic
1148082448 17:44975111-44975133 GGTAAGAGGGAGAGCAGGATTGG + Intergenic
1148164534 17:45473954-45473976 GGGTAGAGGGAGAACAGGAATGG + Intronic
1148203651 17:45766093-45766115 GGTGAGATGGGGCCCAGGGAGGG + Intergenic
1148205326 17:45776107-45776129 GGTGAAGGGGAGCCCAGGGAGGG - Intergenic
1148215949 17:45834129-45834151 GGAGAGAGGCAGCCCTGGGAGGG - Intronic
1148370395 17:47095373-47095395 GGAGGGAGGGAGAGGAGGGAAGG + Intergenic
1149146376 17:53498316-53498338 GGTGTGAAGAAGCCCAGGGAAGG + Intergenic
1149398702 17:56271627-56271649 GCTGTGAGGGTGACCAGGAAGGG + Intronic
1149551293 17:57542129-57542151 AGTGGGAGGGAGCCCAGGGCTGG - Intronic
1149574361 17:57701107-57701129 GGTCAGGGGGAGACCAGAGCTGG + Intergenic
1149911333 17:60569611-60569633 GATGCGAGGGAGAAAAGGGAGGG - Intronic
1150293203 17:63993371-63993393 GGTGGGAGGGAGGGAAGGGAAGG + Intergenic
1150332206 17:64303523-64303545 GGTGAGGGTGACTCCAGGGAAGG - Intergenic
1150395755 17:64820608-64820630 GGGTAGAGGGAGAACAGGAATGG + Intergenic
1150470255 17:65431237-65431259 GGTGAGATGCAGACCATGAAGGG - Intergenic
1150513569 17:65782816-65782838 GGTGGGAGGGAGAAGAGGGTAGG + Intronic
1150526525 17:65929039-65929061 GGTGAGATGGTGATCTGGGACGG + Intronic
1150969171 17:70007662-70007684 GGAGAGAGAGAGACCAGAGAAGG + Intergenic
1151375738 17:73687651-73687673 GGAGAGAGGGAAGTCAGGGAAGG - Intergenic
1151656463 17:75498538-75498560 GGTGAGAGGGCTCCCTGGGAGGG + Exonic
1151702809 17:75752375-75752397 GGTGAGGGGCAGACCGGGCAGGG + Intronic
1151918450 17:77136306-77136328 GGGGAGAGGGAGGGCAGGGCAGG - Intronic
1151957457 17:77387568-77387590 GGGGAGTGGGAGACCAGGCTCGG + Intronic
1152249642 17:79205084-79205106 GGTGGAAGGAAGACCAGGTAGGG + Intronic
1152308662 17:79535988-79536010 GGGGAGAGGGAGGACAGAGAGGG - Intergenic
1152426564 17:80221335-80221357 GGAGAGAGGGTGATGAGGGACGG + Intronic
1152805375 17:82353448-82353470 GGTGAGATGGAGTTGAGGGAGGG - Intergenic
1152920347 17:83063436-83063458 GGTGAGGGGGAGAGCAGGGAGGG - Intergenic
1152928258 17:83097733-83097755 GGTGGGAGGGAGTCCAGCGGGGG + Intergenic
1152980611 18:272771-272793 GGAGAGAGCAAGAGCAGGGAGGG + Intergenic
1153007805 18:512993-513015 CTTGAGAGGGAGACCGTGGAAGG + Intergenic
1153323212 18:3793305-3793327 AGTGAGAGTGAGAACAGGGTGGG - Intronic
1153809828 18:8742276-8742298 GGAGAGAGGGAGAGCAGGAGAGG - Intronic
1153817929 18:8807067-8807089 GGATCGAGGGAGACCTGGGAGGG - Intronic
1154032589 18:10766616-10766638 TGGGAGAGGGAAGCCAGGGATGG - Intronic
1154165625 18:12012244-12012266 GGCCAGAGGGAGCCCAGGGAGGG - Intronic
1154286280 18:13060002-13060024 TGTGAGAGGGAGAGATGGGAGGG + Intronic
1154315942 18:13303464-13303486 GGAGAGAAGGAGGGCAGGGAAGG - Intronic
1155063135 18:22246274-22246296 GGTGAGGTGGAGGGCAGGGATGG + Intergenic
1155190163 18:23422562-23422584 GGAGAGAGGGGGACCAGTTAAGG - Intronic
1155220367 18:23679932-23679954 AGAGAGAGAGAGACCAGGGCTGG - Intergenic
1155514490 18:26610633-26610655 GGAGGGAGGGAGAGAAGGGAGGG + Intronic
1155825659 18:30439414-30439436 GGTGGGAGGGAGACCAGTGCAGG - Intergenic
1156449351 18:37258309-37258331 AGTGAGAGGGAGACCAGGCGCGG - Intronic
1156492159 18:37502676-37502698 GGCTTGAGGGAGATCAGGGAGGG - Intronic
1156985057 18:43341307-43341329 GGAGAGAGGGAGAAGGGGGAAGG + Intergenic
1157182690 18:45511489-45511511 GGTGGGAGTGAGCCCAGGGAAGG - Intronic
1157402039 18:47396663-47396685 GGAGAGTGGGAGTCCAGTGAGGG - Intergenic
1157531290 18:48423096-48423118 GGCGGGAGGAAGAACAGGGAAGG - Intergenic
1157998068 18:52584195-52584217 GGTGAGTGGGATACCAGGAAAGG + Intronic
1158390520 18:57041140-57041162 TGTGACAGGGAGGCCAGGGATGG + Intergenic
1158406576 18:57165419-57165441 GGGGAGGGGGAGAAGAGGGAGGG - Intergenic
1158468727 18:57714570-57714592 GGAGAAAGGGAGAGGAGGGAGGG + Intronic
1158928978 18:62302396-62302418 GGGGAGAAGGTGACCAGGCATGG + Intronic
1158937017 18:62373855-62373877 AGAGAGAGTGGGACCAGGGACGG - Intronic
1159044254 18:63353807-63353829 GGTGTGGGGGTGAGCAGGGATGG + Intronic
1159974823 18:74698557-74698579 TGAGAGAGGGTGACCTGGGAAGG - Intronic
1160043598 18:75367476-75367498 GCTGGGAGGGAGGCCTGGGATGG - Intergenic
1160204382 18:76821679-76821701 GGTGGGAGGGGGAGGAGGGAAGG + Intronic
1160340335 18:78084112-78084134 GGGGTGAGGGAGGCCACGGAAGG - Intergenic
1160373879 18:78396299-78396321 GGGGAGAGGGGGCACAGGGAGGG + Intergenic
1160465642 18:79073618-79073640 CGGGAGACGGAGACGAGGGAGGG + Intronic
1160526890 18:79543617-79543639 GGGGACAGGGAGACCAGGCCTGG + Intergenic
1160594374 18:79964044-79964066 GGTGTGAAAGAGGCCAGGGAAGG + Intergenic
1160854527 19:1210501-1210523 GGTGAGAGCGGGACAAGGCATGG - Intronic
1160951629 19:1670230-1670252 AGAGAGAGAGAGACGAGGGAGGG - Intergenic
1160988541 19:1851336-1851358 GGTGGGAGGGACGCCCGGGAGGG + Intergenic
1161030693 19:2056591-2056613 GGAGAGAAGGGGACGAGGGAAGG - Intergenic
1161083958 19:2325397-2325419 GGTAAGAAGGAGAGCAGGGAGGG - Intronic
1161209050 19:3056846-3056868 GGTGACAGGGAGCCATGGGAGGG - Intronic
1161213620 19:3081565-3081587 GTTGGGAGGGAGAGCAAGGAGGG + Intergenic
1161330161 19:3683111-3683133 GGGGGCAGGGTGACCAGGGAGGG - Intronic
1161345946 19:3768790-3768812 GGTGATGGGGAGGCCAGGCAGGG - Intergenic
1161482282 19:4517110-4517132 GGTGACAGGGAACCCAGGGTTGG - Intronic
1161664466 19:5566841-5566863 GGGGAGACAGAGACCAGAGAGGG + Intergenic
1161723327 19:5915383-5915405 GGAGAGAAGGGGCCCAGGGAAGG - Exonic
1161962494 19:7530245-7530267 GGTCAGAGGGAGCCAAGGCATGG - Intronic
1162199879 19:9012117-9012139 GGGGAGATGGAGAGAAGGGAAGG + Intergenic
1162291733 19:9785717-9785739 GGTGAGAGGGAGATGGGGGCGGG - Intronic
1162292909 19:9792576-9792598 GGTGAGGGGGAGACGGGGGCGGG - Intronic
1162293002 19:9792854-9792876 GGTGAGGGGGAGACGGGGGTGGG - Intronic
1162416394 19:10540619-10540641 GAAGAGAAGGAGACCAAGGATGG + Intergenic
1162526524 19:11209761-11209783 GGTGAGAGGGTGGACAGTGAGGG - Intronic
1162526572 19:11209937-11209959 GGTGAGAGGGTGGACAGGTAAGG - Intronic
1162526737 19:11210624-11210646 GGTGAGAGGGTGAACAGGTGAGG - Intronic
1162792058 19:13068294-13068316 GGTGAGGGGGAGGCAAAGGAAGG + Intronic
1162806705 19:13140914-13140936 GTTGAGTGGGCGGCCAGGGAAGG - Exonic
1162998555 19:14351570-14351592 GGAGAGAGGGTGGTCAGGGAAGG - Intergenic
1163455619 19:17404289-17404311 GGGGGCAGGGAGACCAGGGCTGG - Intronic
1163502954 19:17687207-17687229 GGAGGGAGGGAGACGTGGGAGGG - Intronic
1163817742 19:19477199-19477221 GGAGGGTGGGAGACAAGGGAGGG + Intronic
1163840862 19:19608868-19608890 GGTGACACGGGGACCAGAGAGGG - Intronic
1164425992 19:28142445-28142467 GGAGAGAGGGAGAGAAGGAAGGG + Intergenic
1164603534 19:29579627-29579649 GAGCAGATGGAGACCAGGGAGGG - Intergenic
1164778505 19:30873294-30873316 GGTGAAGGGGTGACCAGGGTAGG - Intergenic
1165072498 19:33263682-33263704 GGGGAGAGGGAGAGGAGAGAGGG + Intergenic
1165330167 19:35137232-35137254 GGTGACAGGGAAACCTGGAATGG - Intronic
1165358567 19:35319313-35319335 GGTGGGAGGCGGGCCAGGGATGG - Intronic
1165393785 19:35552992-35553014 GGAAGGAGGGAGCCCAGGGATGG + Intronic
1165901878 19:39173085-39173107 GGCCAGAGGGGGCCCAGGGAAGG + Exonic
1166126926 19:40720540-40720562 GGAGATAGGGAGGCCTGGGAGGG - Intronic
1166158050 19:40930144-40930166 GGAGAGAGGGAGAGCAGCAAAGG + Intergenic
1166166918 19:40997173-40997195 GGAGAGAGGGAGAGCAGGAGAGG + Intronic
1166343635 19:42152428-42152450 AGAGAGAGGGAGAGAAGGGAGGG - Intronic
1166504149 19:43361115-43361137 GGTGAGAGGGAAAGCTGGGCTGG - Intronic
1166506308 19:43373643-43373665 GGTGAGAGGGAAAGCTGGGCTGG + Intergenic
1166677207 19:44747551-44747573 GGGGAGAGGGAGAGGAGGGGAGG + Intergenic
1166738775 19:45101791-45101813 TGAGACAGGGAGGCCAGGGAGGG + Intronic
1166856356 19:45784299-45784321 GATGAGAGGGAGAGATGGGAGGG + Intronic
1166983000 19:46642707-46642729 GGTGAGAGGGAGAAGAGGTAAGG - Intergenic
1167104424 19:47421869-47421891 GGAGAGAGGGAGAGGAAGGAGGG - Intergenic
1167165665 19:47798272-47798294 GGAGGGAGAGAGACTAGGGAAGG + Intergenic
1167240804 19:48342111-48342133 GGGGAGAGGGAGGGAAGGGAAGG + Intronic
1167249081 19:48391246-48391268 GGTGAGAGGCCCACCAGGGCTGG - Exonic
1167264075 19:48474751-48474773 GGGGGCAGCGAGACCAGGGATGG - Intronic
1167597521 19:50435397-50435419 GGTGCCAGGGAGCCCCGGGAGGG - Intronic
1167622822 19:50568503-50568525 GGAGAGAGGGAGGGGAGGGAGGG + Intergenic
1167654706 19:50756017-50756039 GGTGAGAGGGAGAGCAGTGTCGG - Intergenic
1167656385 19:50767096-50767118 GGTGAGAGGGAGAGCAGTGTCGG - Intergenic
1168067581 19:53927400-53927422 AGGGTGAGAGAGACCAGGGAGGG + Intronic
1168327395 19:55545244-55545266 GTGGAGAGAGAGACCAGGGTGGG - Intronic
1168639445 19:58021000-58021022 GGAGGGAGGGAGAGGAGGGAGGG + Intergenic
1168705153 19:58466635-58466657 AGTGAGAGGCAGAGCTGGGAAGG + Intergenic
1168705835 19:58469844-58469866 GGTGAGAGGGAGCTCAGGGTGGG + Exonic
924998862 2:388052-388074 GGCGAGAGGGGGTCCTGGGATGG + Intergenic
925223950 2:2166187-2166209 GGTGGGAGAGAGAGGAGGGAAGG - Intronic
925282712 2:2695931-2695953 GGTGAGAGGGAGGACTAGGAAGG + Intergenic
925657886 2:6168926-6168948 GGAGGGAGGGAGAGGAGGGAGGG - Intergenic
925935411 2:8753396-8753418 GGCAGGAGGGAGACAAGGGAGGG + Intronic
926116105 2:10214467-10214489 GGTGAGAGGAGGCCCAGGGCAGG + Intergenic
926230831 2:11002670-11002692 GGTGAGGAGGAGAGGAGGGAAGG + Intergenic
926269455 2:11354303-11354325 GGAGGGAGGGAGAGAAGGGAGGG + Intergenic
927019179 2:18999539-18999561 GGAGAGAGAGAGAGAAGGGAGGG - Intergenic
927144501 2:20153708-20153730 GGAGTGCTGGAGACCAGGGAAGG + Intergenic
927812789 2:26189359-26189381 GGTGAGATGGAGGACACGGATGG - Exonic
927990218 2:27442321-27442343 GGTGGGAGGGGGACCCGGGACGG + Intergenic
928093875 2:28392544-28392566 GGTGAGCGGGGGACTGGGGAGGG + Intronic
929428350 2:41866667-41866689 GGTGGGAGGGAGCCAGGGGAAGG - Intergenic
929484575 2:42342282-42342304 GGAGAGGGAGAGAGCAGGGAAGG - Intronic
929570214 2:43018196-43018218 GCTGACAGGGAGAGGAGGGAGGG + Intergenic
929778189 2:44941534-44941556 GGGGAGGGGGAGAGCAGGGAAGG - Intergenic
931233548 2:60394427-60394449 GGTCAGTGGGAGCCCAGGAAAGG + Intergenic
931604254 2:64036353-64036375 GCTGGGAAGGAGCCCAGGGAAGG - Intergenic
931654644 2:64500097-64500119 GGTGAGAGAGGGAGCAAGGAGGG + Intergenic
931668161 2:64624876-64624898 TGTGAAAGGGAGACCAGAGAAGG + Intergenic
932268504 2:70388665-70388687 GGTGGGAGAGAGATCAGAGATGG + Intergenic
932283569 2:70514758-70514780 GGTGGGCAGGAGGCCAGGGAGGG + Intronic
933142861 2:78815426-78815448 GAAGGGAGGGAGACGAGGGAAGG + Intergenic
933427856 2:82135996-82136018 GGAGGGAGGGAGAAAAGGGAGGG - Intergenic
933914677 2:86977976-86977998 AGTGAGAGAGTGGCCAGGGAAGG - Intronic
934008316 2:87791923-87791945 AGTGAGAGAGTGGCCAGGGAAGG + Intronic
934056123 2:88253000-88253022 GAGGGGAGGGAGACGAGGGAGGG - Intergenic
934577315 2:95411120-95411142 AGTGAAAGGGCGGCCAGGGAGGG - Intronic
935321694 2:101895757-101895779 AGGGAGAGGTAGACCAGGTATGG - Intergenic
935700491 2:105807757-105807779 GGAGGGAGGGAGAGAAGGGAGGG - Intronic
935771958 2:106432868-106432890 AGTGAGAGAGTGGCCAGGGAAGG + Intronic
935908111 2:107863077-107863099 AGTGAGAGAGTGGCCAGGGAAGG - Intronic
935994520 2:108755304-108755326 AGTGAGAGAGTGGCCAGGGAAGG - Intronic
936263070 2:110979045-110979067 GGGTAGAGGGAGGCCAGGGGAGG + Intronic
936285510 2:111178378-111178400 AATGAGTGGGTGACCAGGGAAGG - Intergenic
936521266 2:113213310-113213332 GGGGAGAGGGAGAAGAGGGGAGG + Intergenic
936521276 2:113213338-113213360 GGGGAGAGGGAGAAGAGGGGAGG + Intergenic
937387975 2:121454325-121454347 GGAGAGAGGGAGAGCAGGGTGGG - Intronic
937463863 2:122112170-122112192 GGTGTGAGTGGGACCAGGGGCGG + Intergenic
937472795 2:122188377-122188399 GGTGAGGGGCTGACCAGGGGAGG + Intergenic
937509802 2:122582946-122582968 GGGGAAAGGAGGACCAGGGAGGG + Intergenic
937939066 2:127271051-127271073 GGTGAGAGGGAGCCAGGGCAAGG - Intronic
938066459 2:128284318-128284340 GGTGGGAGGGAGGCAAGAGAAGG - Intronic
938163795 2:129009174-129009196 AGGGAGAGGCAGGCCAGGGACGG + Intergenic
938287712 2:130130841-130130863 GGTGAGTGAGAGAGCAGAGAAGG + Intergenic
938427879 2:131208017-131208039 GGTGAGTGAGAGAGCAGAGAAGG - Intronic
938468798 2:131542029-131542051 GGTGAGTGAGAGAGCAGAGAAGG - Intergenic
938582828 2:132662598-132662620 GGAGAGAGGGAGGGCAGGCAAGG + Intronic
938695174 2:133828388-133828410 AAAGAGAGGGAGTCCAGGGAAGG + Intergenic
940652848 2:156454695-156454717 GGAGGGAGGGAGGCCTGGGAAGG + Intronic
941062947 2:160868782-160868804 TGTGAGAGGGAGACCATGAAAGG - Intergenic
941091459 2:161181599-161181621 GGAGAGAGAGAGAGCAAGGAGGG + Intronic
941750737 2:169132922-169132944 AGTGAGAGTGTGACCAGTGAGGG - Intronic
942247837 2:174023938-174023960 GGCCAGTGGGAGGCCAGGGAGGG + Intergenic
942319764 2:174726106-174726128 GCTAAGAGGGAGACCCTGGATGG + Intergenic
942425297 2:175853762-175853784 GGTGAGAGAGAGGCTAGTGATGG + Intergenic
942636732 2:178015749-178015771 GGAGGGAGGGAGAGAAGGGAAGG + Intronic
943036752 2:182756326-182756348 GGTGTAAGGGAGACCACTGAAGG - Exonic
943785701 2:191876154-191876176 AGTGAGAGGGAGAGCTGGGGAGG + Intergenic
945057493 2:205881274-205881296 GGAGAGAGGGAGGGAAGGGAGGG + Intergenic
945057549 2:205881414-205881436 GGAGAGAGGGAGGGAAGGGAGGG + Intergenic
945133759 2:206603500-206603522 GGAGGGAGAGAGAACAGGGAGGG + Intronic
945186369 2:207143996-207144018 GGAGAGAGAGAGGCCAGGGGAGG + Intronic
945234917 2:207625129-207625151 GGTGAGAGGGAGACCAGGCGAGG + Exonic
945958698 2:216109698-216109720 GTAGAGAGGGAGAAGAGGGATGG - Intronic
946147076 2:217739126-217739148 GGTGAGATGCAAAACAGGGATGG - Intronic
946202917 2:218081418-218081440 GCTAAGACAGAGACCAGGGAGGG - Intronic
946421650 2:219568334-219568356 GGGGAGAGAGAGACAAGAGAGGG + Intronic
946740909 2:222800316-222800338 GGGGATAGGGAGACCAGTGAGGG - Intergenic
947382471 2:229558675-229558697 GGTGGGAGGGAGAGCAGTGTAGG + Intronic
947536198 2:230941726-230941748 GTTGAGCTGGAGATCAGGGAAGG - Intronic
947733755 2:232444513-232444535 GGGGAGGGGTAGACCAGAGACGG + Intergenic
947749951 2:232526697-232526719 GTTGGGAGGGAGGGCAGGGATGG + Intronic
947818593 2:233054919-233054941 GGGGAGAGAGAGAGCTGGGAGGG + Intergenic
947927650 2:233935736-233935758 GGTCAGAGAGACAGCAGGGAGGG + Intronic
948325608 2:237117775-237117797 GGTGAGAGGAAATCCAGGCATGG - Intergenic
948501076 2:238395042-238395064 GGTGGGGGGGTGTCCAGGGAGGG + Intronic
948751824 2:240137501-240137523 GGAGAGAGGAAGAACAGGGGAGG + Intergenic
949049972 2:241892396-241892418 GGAGAGAAGGAGACCAGGGAGGG - Intergenic
1168848330 20:960013-960035 TGTGAGAGGGAGACAAGAGGAGG + Exonic
1168917915 20:1506419-1506441 GGCTATAGGGAGACCAGTGAGGG + Intergenic
1169137776 20:3208132-3208154 GATGAAAGGGAGCTCAGGGAAGG + Intergenic
1169348395 20:4848222-4848244 GGTGAGTGGCAGGCGAGGGAGGG + Intergenic
1169945014 20:10978965-10978987 GGGGAGAGGGAGACGGGGCAGGG - Intergenic
1170376703 20:15708353-15708375 GGGGATAGGGAGGTCAGGGAGGG + Intronic
1170434629 20:16313574-16313596 GGTGAGAGGGAGTGCCTGGAAGG - Intronic
1170888765 20:20362799-20362821 GGAGAGAGAGAGAGGAGGGAGGG + Intergenic
1171044573 20:21798005-21798027 GGTCTGAGGGAGACCACCGAGGG + Intergenic
1171044603 20:21798134-21798156 TGGGAGCGGGAGCCCAGGGAGGG + Intergenic
1171151839 20:22834596-22834618 GGAGGGAGGGAGGACAGGGAAGG - Intergenic
1171784004 20:29447269-29447291 GGTCAGAGGCAGAACAGGGCTGG - Intergenic
1172014845 20:31867229-31867251 GGTGAGAGGGAGAGCTGGGCAGG - Intronic
1172062355 20:32195301-32195323 GGTGGGAGGAAGACCAATGAGGG + Exonic
1172185680 20:33029711-33029733 GGTTGAAGGGAGACTAGGGAGGG + Intergenic
1172210278 20:33193069-33193091 GGAGAGACGGAGACCATGAAAGG + Intergenic
1172483372 20:35284696-35284718 GGTGTGAGGGGAACCTGGGAGGG - Intronic
1172720788 20:36999452-36999474 AGGGAGAGGGAGAGGAGGGAGGG - Intronic
1172744489 20:37196213-37196235 GGTGGGGGGGAGACTAGGCACGG - Intronic
1172876827 20:38169558-38169580 GGTGTGAGGGAGCATAGGGAGGG + Intergenic
1172895173 20:38295215-38295237 GGAGGGAGGGAGTTCAGGGAAGG + Intronic
1173291308 20:41717462-41717484 GGTCAGTGGGGGACCAGAGAAGG + Intergenic
1173413127 20:42832363-42832385 GTGGAGAGGGAGAGGAGGGAGGG + Intronic
1173918398 20:46726217-46726239 GGGCAGAGGGGGCCCAGGGAGGG - Exonic
1173987662 20:47275006-47275028 AGAGAGAGAGAGACCAAGGAAGG + Intronic
1174100555 20:48123431-48123453 GTGGAGCTGGAGACCAGGGAGGG - Intergenic
1174200913 20:48805722-48805744 CTTGAGAGAGACACCAGGGATGG + Intronic
1174267289 20:49341083-49341105 TGGGGGAGGGAGACAAGGGAGGG - Intergenic
1174391232 20:50219545-50219567 GGGGACAGGGAGGGCAGGGAAGG - Intergenic
1174392980 20:50229316-50229338 GGTGAAAGGGAGAGGAGGGGCGG - Intergenic
1174522038 20:51139101-51139123 GGTGATAGGGAGCCCCTGGAAGG - Intergenic
1174758366 20:53182130-53182152 GGAGGGAGGGAGAGAAGGGAGGG - Intronic
1174767459 20:53267350-53267372 AGGGAGAGGGAGAGCATGGATGG + Intronic
1175059661 20:56230470-56230492 GGAGGGAGGAAGAGCAGGGAAGG + Intergenic
1175230830 20:57472104-57472126 TGAGAGAGGGAGGCCAGGCAGGG - Intergenic
1175412211 20:58777758-58777780 GGTGGGAGGGAGCCCAGGGCAGG - Intergenic
1175487360 20:59355654-59355676 GGAGATAGGGAGAGGAGGGAGGG - Intergenic
1175618953 20:60427100-60427122 GGGGAGAGGGAGGCCAGGGGAGG + Intergenic
1175748070 20:61475495-61475517 AGAGAGAGGGAGAGGAGGGAGGG - Intronic
1175767738 20:61602944-61602966 GGTGAAAATGAGTCCAGGGAGGG - Intronic
1175828838 20:61951129-61951151 GGTGGGAGGGGGCCCAGGGCTGG - Intergenic
1175871979 20:62213236-62213258 GGGGGAAGGGAGAGCAGGGATGG + Intergenic
1175872070 20:62213456-62213478 GGGGGAAGGGAGAGCAGGGATGG + Intergenic
1175872104 20:62213541-62213563 GGGGGAAGGGAGAGCAGGGATGG + Intergenic
1175872141 20:62213628-62213650 GGGGGAAGGGAGAGCAGGGATGG + Intergenic
1175872178 20:62213715-62213737 GGGGGAAGGGAGAGCAGGGATGG + Intergenic
1176098903 20:63356199-63356221 GGTGTGAGGGAGGGCAGGGGCGG + Intronic
1176098925 20:63356253-63356275 GGTGTGAGGGAGGGCAGGGGTGG + Intronic
1176143928 20:63557159-63557181 GGAGAGAGGGAGCTCAGGGCCGG - Intergenic
1177564192 21:22796664-22796686 GGTGACAGGAAGTGCAGGGAAGG - Intergenic
1178339725 21:31775818-31775840 GGAGGGACAGAGACCAGGGAGGG + Intergenic
1178605479 21:34033016-34033038 GGAGAGAGAGAGAGAAGGGAGGG - Intergenic
1178624721 21:34205035-34205057 GCTGAAAGGGAGCCCAGGGCCGG - Intergenic
1179311263 21:40198263-40198285 GGAGAGAGGGAGACCACAGAAGG - Intronic
1179498889 21:41794395-41794417 GCAGAGAGGGAGACAAGGCAGGG - Intergenic
1179528573 21:42001562-42001584 GGTGAGATGGAGGCCAGGAAGGG + Intronic
1179531054 21:42019952-42019974 GGTGAAAGGGACAGCAGAGATGG - Intergenic
1179578883 21:42325670-42325692 GGTCAGAGAGAGACTTGGGAAGG - Intergenic
1179826259 21:43968174-43968196 GGTGAGCGGGGACCCAGGGAGGG + Intronic
1180100499 21:45581697-45581719 GGGGAGAGGGAGCCCAGGGTTGG + Intergenic
1180469219 22:15640963-15640985 GGTGAGCGGGAGAGTAGAGAAGG - Intergenic
1181119934 22:20658764-20658786 GGTGAGTGGGAGAGTAGAGAAGG + Intergenic
1181745170 22:24951102-24951124 TGTGAGTAGGAGACCAGGAACGG - Intergenic
1181918199 22:26297822-26297844 GGAGAGAGAGAGAGAAGGGAGGG - Intronic
1182022657 22:27094194-27094216 AGTGAGAGGAAGACCAGGAGGGG + Intergenic
1182053669 22:27332443-27332465 GGAGAGAGAGAGACCGGGGATGG - Intergenic
1182086278 22:27563350-27563372 GGTGAGAGGGGGTTCTGGGAAGG + Intergenic
1182158476 22:28098331-28098353 GGTGAGAGGGAACCTAGGGAGGG + Intronic
1182358826 22:29734950-29734972 GGAAGGTGGGAGACCAGGGAGGG + Intronic
1182415383 22:30217937-30217959 GGTGAGAGGGAGACAGGGAGGGG + Intergenic
1182548515 22:31089158-31089180 GGTGAGGGGCAGCCCTGGGACGG - Intronic
1182907164 22:33948421-33948443 GGTGAGAGAGAGAGAAGAGAGGG + Intergenic
1182931448 22:34178231-34178253 GGGGAGAGGGAGAGGAAGGAAGG - Intergenic
1182956537 22:34431991-34432013 GGTGAGAGGAAGAAAAGGGCTGG - Intergenic
1182963594 22:34501106-34501128 GGTCAGAGGCAGAGCAGGTAAGG + Intergenic
1183285702 22:36961512-36961534 GGTCACAGGAGGACCAGGGATGG - Intergenic
1183640194 22:39088100-39088122 CTAGAGAGGGAGCCCAGGGAAGG + Intergenic
1183759719 22:39805044-39805066 GGAGCTGGGGAGACCAGGGAGGG + Intronic
1184091311 22:42294427-42294449 AGCGGGAGGGAGGCCAGGGAAGG + Intronic
1184206757 22:43009428-43009450 GGTGAGAGGGAGCTTAGAGATGG + Intronic
1184345761 22:43911717-43911739 AGGGATGGGGAGACCAGGGAGGG - Intergenic
1184358095 22:43996005-43996027 GATGAGAGGCGGAGCAGGGAGGG - Intronic
1184444721 22:44540411-44540433 GGGGAGAGGGAGCCCAGAAAAGG - Intergenic
1184512308 22:44940826-44940848 GGTGAGATGGATACAGGGGAAGG + Intronic
1184568985 22:45310269-45310291 GCTGAGAGGGAGTCCTGGGGTGG - Intronic
1185039146 22:48495571-48495593 GGGCACAGGGAGCCCAGGGAAGG - Intronic
1185179017 22:49348705-49348727 GGAGAGAGGGAAACCAGAGTGGG + Intergenic
1185285099 22:49996555-49996577 AGTGACAGTGAGACCAGGGTGGG + Exonic
949382816 3:3464983-3465005 GGGAAAAGGGAGACAAGGGAGGG + Intergenic
949880836 3:8659438-8659460 GGGCAGGGGGAGATCAGGGAAGG - Intronic
950172670 3:10850498-10850520 AGTGAGAGGGAGCACAGGGCTGG + Intronic
950447213 3:13045211-13045233 GATGGGAGGGTGGCCAGGGAAGG - Intronic
950520467 3:13494963-13494985 AGGGAGAGGGTGGCCAGGGATGG - Intronic
950582011 3:13868524-13868546 GGTGGGAGGGAGGGAAGGGAAGG + Intronic
951721677 3:25705824-25705846 GGTGGGAGGGCAACCAGTGAGGG + Intergenic
952137825 3:30443102-30443124 GATGACAGGGAGACGAGGGTAGG + Intergenic
952226528 3:31382337-31382359 GGGGAGAGGGATAGGAGGGATGG - Intergenic
952437755 3:33289015-33289037 GCTGAGATGAAGACCATGGAAGG + Intronic
952650658 3:35723113-35723135 GGTGAGTGGGAGGCCAAGGCAGG + Intronic
952773210 3:37020902-37020924 GGGGATATGGAGGCCAGGGAAGG - Intronic
952882126 3:37991593-37991615 AGAGAAAGGGAAACCAGGGAAGG + Intronic
952998058 3:38904570-38904592 GGTGCCAGGGAAATCAGGGATGG - Intronic
953561157 3:43995014-43995036 GGTGAGTGGGGGACCCGGGCGGG + Intergenic
953797332 3:45995584-45995606 GGTCTGAGGGAGACCTGGGATGG + Intronic
954121270 3:48501498-48501520 GGAGAGAGGGAGCCCAGTTAGGG - Intronic
954133532 3:48571767-48571789 GGTGAGAAACAGACCAAGGATGG + Intronic
954287488 3:49629376-49629398 GGTGGGAGGGAGACAAGGCATGG + Intronic
954367266 3:50153220-50153242 AATGGCAGGGAGACCAGGGAAGG - Intergenic
954392146 3:50273492-50273514 GATGAGGGCGAGACCAGGGCAGG - Intronic
954419819 3:50412912-50412934 GGGCACCGGGAGACCAGGGAGGG - Intronic
954437238 3:50502875-50502897 GGTGAGAGGGAAACCCGGGTTGG - Intronic
954633092 3:52057379-52057401 GTTGAGAGGGAGGCAGGGGAAGG - Intergenic
955626683 3:60927005-60927027 TGGGAGACGGAGACGAGGGAGGG - Intronic
955866658 3:63391207-63391229 GGTGAGTGGGCCCCCAGGGAGGG - Intronic
956110691 3:65867442-65867464 TGTGAGTGGGAGGCCAGGCATGG + Intronic
956849709 3:73217735-73217757 GGAGGGAGGGAGAAAAGGGAGGG - Intergenic
957418589 3:79938242-79938264 GGAGAGAGCGAGAGAAGGGAAGG + Intergenic
957691764 3:83580054-83580076 GGTGAGAGGAAGTCAAGAGAAGG + Intergenic
959432486 3:106271639-106271661 GGAAAGAGGAAGACGAGGGAAGG + Intergenic
960223723 3:115146905-115146927 GGTGGGAGGGAGGCGCGGGAGGG - Intronic
960619923 3:119627768-119627790 GGTGAGTGGGGGATCAAGGAGGG - Intronic
960641047 3:119823518-119823540 GGAGAGAGAGAGAGCATGGAAGG + Intronic
961044209 3:123697810-123697832 GGGGAGAGAGAGACCAGGAGAGG - Intronic
961081881 3:124034166-124034188 GGGGAGGGGGAGCCAAGGGAGGG - Intergenic
961175833 3:124834493-124834515 GGAGGGAGGGAGAGGAGGGAAGG + Intronic
961182588 3:124887734-124887756 TGCGAGAGGGAGAGCAGGTACGG + Intronic
961331670 3:126146281-126146303 GGAGAGCGGGAGCCCAGGGAGGG - Intronic
961345566 3:126261123-126261145 GATGAAAGGGCCACCAGGGAGGG - Intergenic
961551909 3:127674243-127674265 GGTGACAGGCAGACCAGAGCAGG - Intronic
961650726 3:128415569-128415591 GGTGGCAGGGAGACCTGGGGAGG - Intergenic
961674003 3:128554089-128554111 GATGAGAGGGAGAGAAGGTAAGG + Intergenic
961963822 3:130881378-130881400 GATGAGAGAGAGACAAAGGAGGG - Intronic
962480451 3:135793706-135793728 GGAGTGAGTGAGAACAGGGAAGG - Intergenic
962539371 3:136363332-136363354 GGAGAGAGGGAGACAAAGAATGG - Intronic
962682492 3:137814841-137814863 GGTCAGAGGGGCACCAGGAAGGG - Intergenic
963200133 3:142578385-142578407 GGTGAGTGGTAAACCAGGGCCGG + Intronic
963677653 3:148333220-148333242 GGTGGTAGGGAGAACAAGGAAGG + Intergenic
963770756 3:149383973-149383995 GGTGAGTGTGGGACCAGGCAGGG + Intergenic
965302009 3:167017489-167017511 AGGGAGAGGGAGACCGTGGAGGG - Intergenic
965302033 3:167017576-167017598 AGGGAGAGGGAGACCGTGGAGGG - Intergenic
965302043 3:167017607-167017629 AGGGAGAGGGAGACCGTGGAGGG - Intergenic
965302051 3:167017632-167017654 AGGGAGAGGGAGACCGTGGAGGG - Intergenic
965302109 3:167017849-167017871 AGGGAGAGGGAGACCGTGGAGGG - Intergenic
965302119 3:167017880-167017902 AGGGAGAGGGAGACCGTGGAGGG - Intergenic
965302127 3:167017905-167017927 AGGGAGAGGGAGACCGTGGAGGG - Intergenic
965603487 3:170477281-170477303 GGAGAGAGGGAGAAGTGGGAAGG + Intronic
965821839 3:172692010-172692032 GGTGAGAGGGAAACCAGACTGGG + Intronic
966140698 3:176752660-176752682 GGAGAGAAAGAGAGCAGGGAAGG + Intergenic
966313899 3:178624822-178624844 GGTGAGTGGGCAGCCAGGGAAGG + Intronic
966839630 3:184078027-184078049 GGTGAGAGAGGTACCAGGGCTGG - Intergenic
966891193 3:184408852-184408874 GGATAGGGGGAGCCCAGGGAAGG - Intronic
967345014 3:188445488-188445510 GGGCAGTGGGAGACTAGGGAGGG + Intronic
967439767 3:189492921-189492943 AGTGCGAGGGAGATGAGGGATGG + Intergenic
967719471 3:192800055-192800077 GGAGAGATGGAGAACAGGGAAGG - Intronic
967834128 3:193946513-193946535 GGGGAGAGGGGGACAAGGGTTGG - Intergenic
968427205 4:531975-531997 GGAGGTGGGGAGACCAGGGAGGG - Intronic
968434381 4:576908-576930 GGTGGGAAGGAGCCCGGGGAGGG + Intergenic
968434409 4:576958-576980 GGTGGGAAGGAGCCCGGGGAGGG + Intergenic
968944638 4:3657256-3657278 GGGAAGAGGGGGACCAGGGGAGG - Intergenic
969061114 4:4435921-4435943 GGGGAGAGGGATGGCAGGGATGG + Intronic
969161468 4:5262984-5263006 GGTGGGAGGGTGATCAGGGGAGG - Intronic
969212823 4:5700775-5700797 GGAGAGAGGGATGACAGGGAGGG - Intronic
969481288 4:7448440-7448462 GGAGGGAAGGAGACGAGGGAGGG - Intronic
969481438 4:7448934-7448956 GGAGAGAGGGAAAAGAGGGAGGG - Intronic
969615910 4:8252500-8252522 GGTGGGAGGCAGAACAGGGGAGG + Intergenic
969703345 4:8779608-8779630 GGTGGGAAGCAGACCAGCGAGGG - Intergenic
970233957 4:13939848-13939870 GGTGAGATGGAGACCACAGGAGG + Intergenic
970502650 4:16693875-16693897 GCTGAGAGGGAGAGAAAGGATGG - Intronic
970567249 4:17344003-17344025 GGTGAGAGGGAGACTAAAGTGGG - Intergenic
970673895 4:18426414-18426436 GGTGAGCGGGAGGCTAGGGGAGG + Intergenic
970858566 4:20676125-20676147 GGAGAGAGGGAGAGAAGAGAGGG + Intergenic
970992015 4:22223549-22223571 TTAGAGAGGGAGACCGGGGAAGG - Intergenic
971154193 4:24064489-24064511 GGTGACAGGGAGAAGAGGGCAGG + Intergenic
971246514 4:24934005-24934027 GGTGAGAATGACACCATGGAGGG - Intronic
971365302 4:25972242-25972264 GGTGGGTGGGAGAAAAGGGAGGG + Intergenic
971698427 4:29935846-29935868 GGTGGGTGGGGGACTAGGGAAGG + Intergenic
972665442 4:41160650-41160672 GGTGAGAGGGAGACCAGGGAAGG - Intronic
973656062 4:53048884-53048906 GGTGTGTGGGAGTCCAGGGAAGG - Intronic
974648099 4:64719300-64719322 GGTGACAGGGAGAAGAGGGCGGG + Intergenic
975849928 4:78561634-78561656 GATGTGAGGGAGACCAGAGGAGG - Intronic
977294128 4:95192598-95192620 GGGGAGAAGGTGAGCAGGGAAGG - Intronic
977810218 4:101348105-101348127 GGTGAGAGGCAGCCCTGAGAGGG + Intronic
977989070 4:103419685-103419707 GGAGAGAGAGAGAGCAAGGATGG + Intergenic
978233668 4:106431398-106431420 GGTGAGAGTGGTACCAGGGGAGG + Intergenic
979516071 4:121611690-121611712 GGAGTGAGGGAGAATAGGGAAGG + Intergenic
979874624 4:125872401-125872423 TGTGAGAGGGAGACTTGGGAAGG - Intergenic
981330747 4:143506118-143506140 GGTGAGAGAGAGAGGAGCGAAGG + Intergenic
981590926 4:146360085-146360107 GGTGAGAGGGAGAGGAGTTAAGG - Intronic
982660437 4:158200269-158200291 GGTGAGAGAGAAAGCAAGGAGGG - Intergenic
982723262 4:158881188-158881210 AGGGAGAGGGAGACCGTGGAGGG - Intronic
982856270 4:160385883-160385905 CGTGAGAGGAAGGCCAAGGAGGG - Intergenic
984512414 4:180694501-180694523 GGTAAGAGGGAGCCAATGGATGG - Intergenic
984550389 4:181152551-181152573 GGAGAGAGGGAGAGCATGAAAGG + Intergenic
984770353 4:183431905-183431927 GGTGAGGGGGAGGCCAGGGGAGG + Intergenic
984804410 4:183737780-183737802 AGGGAGAGGGAGACCGTGGAGGG + Intergenic
984826763 4:183931954-183931976 GGAGGCATGGAGACCAGGGAAGG + Intronic
985677057 5:1237603-1237625 TGGGAGAGGGAGGCCAGGGAGGG + Intronic
986299533 5:6467173-6467195 GGAGGGAGAGAGAGCAGGGAGGG - Intronic
986530100 5:8726988-8727010 GGAGAGAGGGAGGGGAGGGAGGG + Intergenic
986592542 5:9386454-9386476 GGTGAGAGGGACCACAGGGAAGG - Intronic
986733761 5:10653413-10653435 GGAGTGCAGGAGACCAGGGAGGG + Intergenic
987051940 5:14154236-14154258 GGGGAGAGGCTGGCCAGGGAGGG + Intronic
987562804 5:19546011-19546033 GGAGAGAGGGAAAACTGGGAAGG + Intronic
988502957 5:31798888-31798910 GGTGTGAATGAGCCCAGGGAAGG + Exonic
989173209 5:38494120-38494142 TGGGAGAGGGAGACTGGGGAGGG + Intronic
990032812 5:51282617-51282639 GGTGAGAAGGAGGCCAAGTAAGG - Intergenic
992184655 5:74232386-74232408 AGAGAGAGGGAGGACAGGGATGG - Intergenic
992499795 5:77330747-77330769 GGTGATAGAGAGCCCAGTGATGG + Intronic
993969771 5:94404893-94404915 GGGGAGAGGGTGACAAGGGCTGG + Intronic
994285863 5:97965958-97965980 GGTGGGTGGGGGACCAGGCATGG - Intergenic
994952356 5:106480705-106480727 AGAGAGAGAGAGACGAGGGAGGG - Intergenic
995752950 5:115472732-115472754 GGAGAGAGGGAGGCCAAGGGAGG + Intergenic
995945396 5:117638934-117638956 GAGGGGAGGCAGACCAGGGATGG - Intergenic
996771292 5:127088554-127088576 GGAGAGAGGGAGAAGAGGGGAGG + Intergenic
997819642 5:137053366-137053388 GGGGAGGAGGAGACCAGAGATGG - Intronic
998158271 5:139798254-139798276 GGTCCCAGGGAGACCAGGGCAGG - Intronic
998167483 5:139852466-139852488 GGTGAGAAGGAGAACAGGAGTGG + Exonic
998205919 5:140156874-140156896 GCTCTGAGGGAGAACAGGGAAGG + Intergenic
998243160 5:140469105-140469127 GGAGAGAAGGAGAGAAGGGAGGG - Intronic
998372425 5:141670490-141670512 GGTGAGGGGGAGCCAAGGGATGG - Exonic
999247047 5:150160609-150160631 GCTGAGAGGGAGGCCAGCAAGGG - Intergenic
999282724 5:150375677-150375699 CGGGAGAGGGAGCCCAGGGTAGG - Intronic
1000103602 5:158037980-158038002 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1000152167 5:158513945-158513967 GGAGAGAGGGAGAGAAGGAAGGG + Intergenic
1000342574 5:160289135-160289157 GGTAGGAGGGAGGTCAGGGATGG - Intronic
1000364878 5:160481455-160481477 GGAGGGAGGGAGAGAAGGGAAGG - Intergenic
1000507968 5:162145509-162145531 AGTGAGAGGCAGAGTAGGGATGG - Intronic
1000531048 5:162420280-162420302 GGAGAGAGGGAGATGGGGGAAGG + Intergenic
1001291420 5:170465354-170465376 TGTGAGAGGGAAGCAAGGGAAGG - Intronic
1001322048 5:170690711-170690733 GGTGAGAGAGAGCCTAGAGAGGG - Intronic
1001417990 5:171561784-171561806 GGTGGCAGGGAGAGCTGGGAAGG - Intergenic
1001597437 5:172907152-172907174 TGCAAGAGGGAGACCAGGCAGGG - Intronic
1001646095 5:173283430-173283452 GGAGAGAGGGAGATAAGAGAGGG + Intergenic
1001668490 5:173453778-173453800 GGGGAGAGTGAGACAAGGAAGGG - Intergenic
1001672030 5:173481708-173481730 GGTGGGAGGGAGGCAAGGAAGGG - Intergenic
1001689866 5:173625047-173625069 GGAGGCAGGGAGACCAGAGAGGG + Intergenic
1002031353 5:176433028-176433050 AGGGAGAGGGAGAGGAGGGAGGG - Intergenic
1002273237 5:178086555-178086577 GGGGAGAAGGAAACCAGGCACGG - Intergenic
1002315701 5:178341713-178341735 GGTGAGTGGGAGACGAGGTCAGG - Intronic
1002331861 5:178448607-178448629 GGTGAGAGAGAGAGCAAGAAGGG + Intronic
1002765570 6:235866-235888 AGAGAGAGGGAGAGGAGGGAAGG + Intergenic
1004185348 6:13416596-13416618 GGTGAGGGGGAGAGCTGGGCAGG + Intronic
1006059065 6:31405692-31405714 GGGGAGTGGGGGAGCAGGGATGG - Intronic
1006096054 6:31657504-31657526 GGTTGGAGGGAAACAAGGGAGGG + Intronic
1006150049 6:31982235-31982257 GGAGTGAGGGAGAGCAGGGGTGG + Intronic
1006156350 6:32014973-32014995 GGAGTGAGGGAGAGCAGGGGTGG + Intronic
1006191545 6:32212761-32212783 GCTGGGAGGGAAACCAGGGAGGG - Intronic
1006876705 6:37303804-37303826 GGTCAGGGGGACCCCAGGGAAGG - Intronic
1006918992 6:37615344-37615366 GGAGGGAGGGAGAAAAGGGATGG - Intergenic
1007306448 6:40910070-40910092 GGTTGGAGGGAGGACAGGGATGG + Intergenic
1007372004 6:41432222-41432244 GGAGACAGGGACACCAGGGTGGG - Intergenic
1007545150 6:42687478-42687500 GGGGAGAGGGAGAGAAGAGAGGG + Intronic
1007599343 6:43072120-43072142 GGTGAGAAAGAGACCAGAGAAGG - Intronic
1007880118 6:45155390-45155412 GGGGAAAGGGAGATGAGGGAAGG + Intronic
1008273368 6:49515922-49515944 GGAGAGAGGGAGGGGAGGGAGGG - Intronic
1008319915 6:50098348-50098370 GGTGACAGAGAGACCAGTGTGGG + Intergenic
1009353539 6:62710323-62710345 AGTGGGAGGGGGACGAGGGAAGG + Intergenic
1009941754 6:70298079-70298101 GTTGACAAGGAGACTAGGGATGG - Intronic
1010507255 6:76675639-76675661 GGAGGGAGGGAGAGAAGGGAAGG - Intergenic
1013009532 6:106106878-106106900 GGGGAGAGAGACAGCAGGGAAGG - Intronic
1013472448 6:110476945-110476967 GCTGAGAGAGAGCCCAGGGTGGG + Intergenic
1013546587 6:111163877-111163899 GGTGTGGGAGAGACCAGAGATGG - Intronic
1014006449 6:116424777-116424799 TCTGATAGGGTGACCAGGGAAGG + Intronic
1014253714 6:119140745-119140767 GGTGAAAGGGAGGCGAGGGAGGG + Intronic
1014749254 6:125236779-125236801 GGTAAAAAGGAAACCAGGGAAGG - Intronic
1014761306 6:125359741-125359763 AGAGAGAGGGAGAAGAGGGAGGG + Intergenic
1016345656 6:143111421-143111443 GGTAGGAAGGAGACCAGGAAAGG - Intronic
1016480039 6:144471020-144471042 GGGGAGAGGGAGACGAGGGAGGG + Intronic
1016712803 6:147192700-147192722 GGGGAGAGGGAGAGTAGGTAAGG + Intergenic
1017128726 6:151090265-151090287 GGGGAGAGGGAGAGAAGGAATGG - Intronic
1017204107 6:151786397-151786419 GGTGAGCTGGAGACCTGGCACGG + Intronic
1017927747 6:158924757-158924779 GGGGAGAGGGAGAAGAGGGAGGG + Intergenic
1018308499 6:162483572-162483594 GGAGAGAGGGAGACGGGGAAAGG + Intronic
1019158894 6:170056630-170056652 GATGAGGGGGAGACCCGGGGCGG - Intergenic
1019478286 7:1254615-1254637 GGTGGGGGGGACACCAGGCAGGG - Intergenic
1019701320 7:2476162-2476184 TGTGACAGGGTGACCAGGGCTGG + Intronic
1020036064 7:4963741-4963763 CTTGAGACGGAGAGCAGGGACGG - Intergenic
1020095985 7:5369606-5369628 AGAGAGAGAGAGACTAGGGAAGG + Intronic
1021247932 7:18287674-18287696 GATGTGAAGGAGACCAGGGCAGG - Intronic
1021672643 7:23047365-23047387 GGGGAGAGGGAGACGAGAGGGGG + Intergenic
1021829860 7:24594602-24594624 GAGGAGAGGGAGACGAGGAATGG + Intronic
1021940867 7:25677998-25678020 GGTGTGAGGGGCACCAGGAAAGG + Intergenic
1022514057 7:30964294-30964316 GGGCAGAGGGAGATGAGGGAGGG - Intronic
1022889711 7:34683681-34683703 GGTGAGAGAGGGACAAGGGAGGG + Intronic
1022964744 7:35462174-35462196 GGTGGGATGGACACCAGGGATGG - Intergenic
1023043538 7:36193193-36193215 GGTGAGTGGGATGGCAGGGAAGG + Intronic
1023393464 7:39732051-39732073 GGGGAGAGGGTGACCAGAGAGGG - Intergenic
1023582892 7:41700797-41700819 GGAGAGAGGGAGGGAAGGGAGGG + Intronic
1023746524 7:43327538-43327560 GGTGGTAGGGACAGCAGGGAGGG - Intronic
1023860940 7:44217460-44217482 GGTGAGAGGGAGAGGAGGGGAGG + Exonic
1023990583 7:45126122-45126144 GGTGGTGGGGAGTCCAGGGATGG - Intergenic
1023995613 7:45157589-45157611 GGTGAGAGGGGGGCGAGGGCAGG - Intergenic
1024618083 7:51132805-51132827 GGTGAGAGAGGGAGCAAGGACGG + Intronic
1024786185 7:52910848-52910870 GGTGAGAGGAAAACCTGGGGTGG + Intergenic
1025927042 7:65968508-65968530 GGTGAGGGGAAGCCCAGTGATGG - Intronic
1026050163 7:66939898-66939920 GGGCTGAGGGTGACCAGGGAAGG + Intronic
1026196976 7:68181601-68181623 GGAGGGAGGGAAACAAGGGAGGG + Intergenic
1026958562 7:74393973-74393995 GGAGAAAGTGAGACCAGGCAGGG - Intronic
1027429514 7:78095680-78095702 GGTGGGATGGAGAGAAGGGATGG + Intronic
1027480154 7:78685740-78685762 GGTGATAGGGAGACAAAGAAGGG + Intronic
1028309638 7:89315141-89315163 GGTGAGAGCGAGAGCAAGGCGGG + Intronic
1028482098 7:91318064-91318086 AGAGGGAGGGAGAACAGGGAAGG + Intergenic
1028576153 7:92353625-92353647 GGTAAGAAGTAGACCAGGGTAGG - Intronic
1029204414 7:98860342-98860364 GGAGAGAGAGAGACACGGGAGGG + Intronic
1029454338 7:100660628-100660650 GGTGAAAAGGAGGCCAGGGCCGG + Intergenic
1029546755 7:101214419-101214441 GGAGAGAGAGAGGCCAGGCACGG - Intronic
1030099330 7:105931326-105931348 GGAGAGAGGGAGGAAAGGGAAGG - Intronic
1031491689 7:122397446-122397468 GGGGAGAGGGAGAGGAGGGGTGG + Intronic
1032006472 7:128305806-128305828 GGGGAGAGGGAGAAAAGGGGTGG + Exonic
1032062270 7:128735118-128735140 GGAGAGAGGGACACCATGTAGGG - Intergenic
1032513114 7:132487717-132487739 CATGAGAGGAAGACCCGGGAAGG + Intronic
1032546787 7:132750689-132750711 GGAGAGAGGGAGAGAAGGGAGGG - Intergenic
1032876723 7:136045921-136045943 TGAGTGAGGGAGATCAGGGAGGG + Intergenic
1033629778 7:143146335-143146357 GGTGACAGCAAGACCAGGGAGGG - Intergenic
1034100894 7:148449512-148449534 AGAGAGAGAGAGACCAGGGTTGG - Intergenic
1034275592 7:149822455-149822477 GGTGAGAGGGAGGGCAGGCAGGG + Intergenic
1034448899 7:151127053-151127075 GGTGAGGGGGAGGCCAGAAAGGG - Intronic
1034511407 7:151537890-151537912 GAAGAGACGGAGACCAGGCAAGG - Intergenic
1034572748 7:151970183-151970205 GGTGAAAGGGAAAGCAGGAAGGG + Intronic
1034928517 7:155142100-155142122 CGAGAGAGGGAGAAGAGGGAGGG - Intergenic
1035176726 7:157057022-157057044 GATGAGCGGGACAACAGGGAAGG - Intergenic
1035234477 7:157487519-157487541 GGGGAGATGAAGACCAGGGCGGG + Intergenic
1035287300 7:157814537-157814559 GGACAGAGGGAGGACAGGGACGG + Intronic
1035470539 7:159106416-159106438 GGGCAGAGAGAGGCCAGGGAGGG + Intronic
1035470579 7:159106540-159106562 GGGCAGAGAGAGGCCAGGGAGGG + Intronic
1035470586 7:159106561-159106583 GGGCAGAGAGAGGCCAGGGAGGG + Intronic
1035470611 7:159106643-159106665 GGGCAGAGAGAGGCCAGGGAGGG + Intronic
1035470638 7:159106721-159106743 GGGCAGAGAGAGGCCAGGGAGGG + Intronic
1035476706 7:159149160-159149182 GGTGGGAGGGGGACCCGGGCAGG - Intergenic
1035718243 8:1770352-1770374 GGTGAGAGTGGAACCAGAGAAGG + Intronic
1035902384 8:3471543-3471565 GGAGGGAGGGAGAGGAGGGAGGG - Intronic
1035904012 8:3489455-3489477 GGCCAGAGGGAATCCAGGGAAGG + Intronic
1036017404 8:4800572-4800594 CGTCAGAGGCAGAGCAGGGAAGG + Intronic
1036708081 8:11059743-11059765 GGTGAGAGGGAGCCGCGGGGCGG - Intronic
1036961416 8:13248719-13248741 GTGGAGAGGGAGACATGGGATGG - Intronic
1036962833 8:13264581-13264603 GGGGAGCGGGAGAGGAGGGAAGG + Intronic
1037590360 8:20306745-20306767 GTGGAGAAGGAGACCAGTGATGG + Intergenic
1037875673 8:22546534-22546556 GGTAAGAAGGAGGCCAGGGTTGG - Intronic
1037919843 8:22798052-22798074 GCTAAGAGGGAGGCCAGAGAAGG + Intronic
1039260563 8:35766874-35766896 GGGGAGACGGAGAGAAGGGATGG - Intronic
1039967467 8:42293625-42293647 GGGGAATGGGAGCCCAGGGACGG + Intronic
1040029929 8:42814778-42814800 GGTGAGAGAGAGACCACCCAGGG - Intergenic
1041258688 8:56001388-56001410 GCTGAGATGCAAACCAGGGAAGG + Intronic
1041564591 8:59262306-59262328 GGTGAGAGGGAAATCAGGAGAGG - Intergenic
1041618187 8:59932746-59932768 TGTCAGAGGGAGACCAAGGGAGG - Intergenic
1043533113 8:81171976-81171998 GAGCAGAGAGAGACCAGGGACGG + Intergenic
1043826138 8:84930798-84930820 GGAGAGAGAGAGAATAGGGAAGG + Intergenic
1043988678 8:86724930-86724952 GGTGAGAGACAGACCAGGCAGGG + Intronic
1044061859 8:87648424-87648446 GGTGAGATATAGACAAGGGAAGG + Intergenic
1047404395 8:124573203-124573225 GATGAGAGGGAGAGGAGAGAGGG - Intronic
1047445582 8:124916214-124916236 GGGAAGAAGAAGACCAGGGAAGG - Intergenic
1047613968 8:126547611-126547633 GGTGACAGGAAGGGCAGGGAAGG + Intergenic
1047648563 8:126895339-126895361 AATGAGAGGGGGACCAGGGCAGG + Intergenic
1048070253 8:131013324-131013346 GGGCAGAAGGAGAGCAGGGAGGG + Intronic
1048141774 8:131801956-131801978 GGTGAGAAGGAGACAGGTGAGGG + Intergenic
1048160693 8:132018299-132018321 GGTGAGATGTAGACCAAGGGAGG + Intergenic
1048180977 8:132193884-132193906 AGCCAGAGGGAGAGCAGGGAAGG + Intronic
1048294005 8:133200931-133200953 GATGAGAGGGAGGGCAGAGAGGG - Intronic
1048300305 8:133246354-133246376 GGGGATAGAGGGACCAGGGATGG - Intronic
1048830543 8:138472536-138472558 GGTGGGAGGTAGACAACGGAAGG + Intronic
1049121268 8:140740305-140740327 ACTGAGAGGATGACCAGGGAAGG + Intronic
1049130231 8:140832908-140832930 GGTGAGGGAAAGACCAGGGCAGG + Intronic
1049245222 8:141558860-141558882 GGTGAGAGGGGCACATGGGAGGG - Intergenic
1049370282 8:142261095-142261117 GAAGAGAGGGGGAGCAGGGAAGG + Intronic
1049377006 8:142294061-142294083 GGAGTAAGGGAGCCCAGGGAGGG + Intronic
1049469571 8:142769336-142769358 GGGAAGAGGGAGTCCCGGGAGGG + Intronic
1049585926 8:143432363-143432385 GTTGAGAGGGAGGCCCGGGAAGG + Intergenic
1049632549 8:143666470-143666492 GGAGAGAGGGAGGCCACGCATGG - Intergenic
1049714630 8:144084059-144084081 CCTGAGAGGGGGACCAGGGCAGG - Intronic
1049811943 8:144579576-144579598 GATGAAAGGGAGGCCAGGGATGG - Intronic
1051022684 9:12563819-12563841 CGAGAGAGAGACACCAGGGAAGG + Intergenic
1051388652 9:16539605-16539627 GGAGAGAGAGAGAGAAGGGAGGG + Intronic
1051388662 9:16539642-16539664 GGAGAGAGAGAGAGAAGGGAGGG + Intronic
1051934106 9:22423276-22423298 GGTGAGAGCAAGAACAGGGGTGG - Intergenic
1052655058 9:31348333-31348355 GGTCAGAGACAGACCAGTGATGG + Intergenic
1052833512 9:33233974-33233996 TGTGAGCTGGAGGCCAGGGAAGG + Intronic
1052840834 9:33289780-33289802 GGTGAGTGGGCGGCCAGGGAAGG - Intergenic
1053157482 9:35791361-35791383 GGCGTGGGGGAGACCAGGGTAGG + Intergenic
1053654169 9:40198121-40198143 GGTGAGCGGGAGAATAGAGAAGG + Intergenic
1053665980 9:40317925-40317947 GATGGGAGGGGGACCGGGGATGG + Intronic
1053904558 9:42827297-42827319 GGTGAGCGGGAGAATAGAGAAGG + Intergenic
1053915561 9:42942970-42942992 GATGGGAGGGGGACCGGGGATGG + Intergenic
1054366283 9:64344337-64344359 GGTGAGCGGGAGAATAGAGAAGG + Intergenic
1054518630 9:66058358-66058380 GATGGGAGGGGGACCGGGGATGG - Intergenic
1054530426 9:66178218-66178240 GGTGAGCGGGAGAATAGAGAAGG - Intergenic
1054673914 9:67834067-67834089 GGTGAGCGGGAGAATAGAGAAGG + Intergenic
1054946894 9:70805206-70805228 GGTGAGAGAGAGACTGGGGTGGG + Intronic
1055151562 9:73006639-73006661 GGTGAGTGGGGGACCAGGTGGGG - Intronic
1055321575 9:75088139-75088161 GGTTAGAGGGATGCCAGGTAGGG + Exonic
1056216661 9:84411490-84411512 GGTGATAGGCAGAGCAGGGGTGG + Intergenic
1056447401 9:86679083-86679105 GGAGAGAAGGAGAAGAGGGAAGG - Intergenic
1056576618 9:87859749-87859771 AGTGAGCGGGAGCCCAGCGAGGG + Intergenic
1056738056 9:89226406-89226428 GGTGAGAGTGAGTCTAGGGCTGG - Intergenic
1056749121 9:89333590-89333612 TGAGAGAGGGAGAGTAGGGAAGG + Intronic
1056791428 9:89627733-89627755 GGTGAGATAAAGACCAGGGCAGG + Intergenic
1057147429 9:92767702-92767724 GGTGGAAGGGAGGCCAGGGAAGG + Intergenic
1057379719 9:94556358-94556380 GGTGAGCGGGAGAGTAGAGAAGG + Intergenic
1057403474 9:94745203-94745225 GGTAGGAGGGAGAACGGGGATGG - Intronic
1058432812 9:104933791-104933813 AGAGAGAGAGAGGCCAGGGACGG + Intergenic
1059086711 9:111310892-111310914 GCTGAGAGGGGGAGGAGGGAGGG - Intergenic
1059980194 9:119763040-119763062 GGTTAGAGGCAGACCAGGGCTGG + Intergenic
1060300681 9:122372981-122373003 GGGTATAGGGAGCCCAGGGAAGG + Intronic
1060406328 9:123374794-123374816 GGTGACTGTGATACCAGGGAGGG - Intronic
1060466906 9:123914712-123914734 AGTGAGAGTGAAACAAGGGAGGG + Intronic
1060750686 9:126166439-126166461 GGGGAGAGGGACACTGGGGAGGG + Intergenic
1060967088 9:127717424-127717446 GGTGAGAGGCAGACCTGGGTGGG + Exonic
1061128135 9:128689532-128689554 GGGGAGGGGGAGAGAAGGGAAGG - Intronic
1061291567 9:129653442-129653464 GGAGAGAGGGGTATCAGGGAGGG - Intergenic
1061419701 9:130466564-130466586 GGTGAGAGGGAGCCCCATGAAGG - Intronic
1061484019 9:130911387-130911409 GGTGCCAGGGACACCAGGCATGG - Intronic
1061538782 9:131266163-131266185 GGAGGCTGGGAGACCAGGGAGGG - Intronic
1061722649 9:132562331-132562353 GAGGAGAGTGAGCCCAGGGAGGG - Intronic
1061890507 9:133616794-133616816 GGCGAGAGGGGGACGTGGGAGGG + Intergenic
1061907079 9:133704277-133704299 GGTGAGACGCAGCCCCGGGAAGG + Intronic
1061974179 9:134060054-134060076 GCTGAGTGGGAGACCCGGGGAGG - Intronic
1062017917 9:134301032-134301054 GGAGAAAGGGAGAACAGGGATGG + Intergenic
1062261068 9:135663627-135663649 GGTTAGAGGGGGCCCTGGGAGGG + Intronic
1062351640 9:136142535-136142557 GTGGAGAGGGAGCCCTGGGAGGG - Intergenic
1062497169 9:136837413-136837435 GGTGACTGGGAGCCCGGGGATGG - Exonic
1062555678 9:137112550-137112572 GCTGAGAGGGTCCCCAGGGACGG + Intronic
1185456346 X:312719-312741 GGTGACACGGAGACCGCGGAAGG + Intronic
1185630855 X:1514867-1514889 GGGGAGAGGAAGACAGGGGAAGG - Intronic
1185641795 X:1592525-1592547 GGTCAGTGGGGCACCAGGGAGGG - Intronic
1185708444 X:2282534-2282556 GGAGATAGGGAGAAGAGGGAGGG + Intronic
1185734269 X:2485530-2485552 GGAGGGAGGGAGAAAAGGGAGGG + Intronic
1185829799 X:3289851-3289873 GATGGGAGGGAGATCTGGGATGG - Intergenic
1185935933 X:4257282-4257304 CATGAGAGGGAGGCCAAGGAAGG + Intergenic
1186473980 X:9842870-9842892 GGAGAGAAGGAGGGCAGGGAGGG + Intronic
1187043037 X:15616963-15616985 GGAGAGATGGAGTCCTGGGAGGG - Intergenic
1187798127 X:23027121-23027143 GTTGAGAGGGTGGCCAGGGAAGG - Intergenic
1187967624 X:24627960-24627982 GGTGGGAGGGACAACAAGGATGG + Intronic
1188006210 X:25017142-25017164 GGTGAGAGAGGGGCCAGGGAGGG + Intergenic
1189476803 X:41362434-41362456 GGAGACAGGGAGACCAGGTAAGG - Intronic
1189667362 X:43370982-43371004 GGGGAGAGGGAGAGGAGGGAGGG + Intergenic
1190010329 X:46779100-46779122 CGTGACAGTGAGACCAGGCACGG + Intergenic
1190184008 X:48219253-48219275 GGAGAGAGAGAGAGCAGGGAGGG + Intronic
1190199094 X:48345017-48345039 GGAGAGAGAGAGTGCAGGGAGGG - Intergenic
1190397920 X:50003496-50003518 TGTGAGAGAGGGAGCAGGGAAGG - Intronic
1190665855 X:52695485-52695507 GGAGAGAGAGAGTGCAGGGAGGG - Intronic
1190673563 X:52762925-52762947 GGAGAGAGAGAGTGCAGGGAGGG + Intronic
1190778799 X:53577542-53577564 CATCAGAGGGAGACCATGGAAGG - Intronic
1191204198 X:57816941-57816963 GGTGAAAAGGAGAAGAGGGAGGG + Intergenic
1191835201 X:65456462-65456484 CATCAGAGGGAGACCATGGAAGG - Intronic
1191904905 X:66077257-66077279 GGAGAGAAGGAGAGAAGGGAAGG - Intergenic
1192173722 X:68873203-68873225 GGAGACAGGGAGCCCAGGGAAGG - Intergenic
1192678433 X:73225284-73225306 AGTTAGATGGAGAACAGGGATGG + Intergenic
1194104956 X:89757388-89757410 GGTGACAAGGAGAAGAGGGAAGG + Intergenic
1194149691 X:90309016-90309038 GGTGAGAGAGAGAGCAAAGAGGG + Intergenic
1194507024 X:94745749-94745771 GGTGTGGGGGAGAGGAGGGAAGG - Intergenic
1195022806 X:100846612-100846634 GGAGAGAGAGAGACTAGCGAGGG - Intronic
1195264373 X:103165790-103165812 GGAGGGAGGGAGAGAAGGGAGGG - Intergenic
1195420298 X:104667913-104667935 GGTGTGAGGGTGATTAGGGAAGG + Intronic
1196210160 X:112986923-112986945 ACTTAGAGGGAAACCAGGGAGGG - Intergenic
1197148024 X:123190266-123190288 GGAGAGAGGGAGAGCAGCAAAGG - Intronic
1197199131 X:123733511-123733533 GGGGAGAGGGAGACGGGAGAGGG - Intergenic
1197256001 X:124263984-124264006 GGGGAGAGGGAGGGAAGGGACGG - Intronic
1197640877 X:128966701-128966723 GGTGAGAGGAAGGCAAGGAAGGG + Intergenic
1197756983 X:130002479-130002501 AGACAGAGGGAGACCGGGGAGGG + Intronic
1197833461 X:130670214-130670236 GGTGAAAGGGAGAGGAGAGAGGG + Intronic
1198055178 X:132987128-132987150 GGGGAAAGGGAGACCAAGAATGG - Intergenic
1198961445 X:142187696-142187718 CGTGTGAGGCAGAGCAGGGAGGG - Intergenic
1199047468 X:143193290-143193312 GGAGAGAGAGAGACCAGTGGAGG - Intergenic
1199316581 X:146385566-146385588 GGGGAGAGAGAGAAAAGGGAAGG + Intergenic
1199761160 X:150905109-150905131 GGAGTGAGTGAGACCAGGGGAGG - Intergenic
1199800522 X:151246874-151246896 GGACAGAGGGAGCCCAGGGTAGG + Intergenic
1199982741 X:152929713-152929735 TGTGGAAGGGAGTCCAGGGATGG - Intronic
1199993758 X:153005887-153005909 AGAGAGAGAGAGAGCAGGGAAGG + Intergenic
1200072334 X:153535447-153535469 GGAGGGAGGGAGAAGAGGGAGGG - Intronic
1200217174 X:154373096-154373118 GGTGGGAGGGAGGGCTGGGAAGG + Intronic
1200456922 Y:3405177-3405199 GGTGACAAGGAGAAGAGGGAAGG + Intergenic
1200496068 Y:3885751-3885773 GGTGAGAGAGAGAGCAAAGAGGG + Intergenic
1201253898 Y:12088395-12088417 AGAGAGAGGGAGACAAGGAAAGG - Intergenic