ID: 972666781

View in Genome Browser
Species Human (GRCh38)
Location 4:41172414-41172436
Sequence AAGGCTTCTCTCACCAACCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 142}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972666781 Original CRISPR AAGGCTTCTCTCACCAACCT CGG Intronic
901062349 1:6477658-6477680 AAGGCTTCTGTCCCCACCCCAGG - Exonic
901314985 1:8300930-8300952 AAGGCCTCTCTCACCAGCCCTGG + Intergenic
901508597 1:9702357-9702379 AAGGCGTCTCTCTTCAGCCTAGG - Intronic
902291337 1:15437298-15437320 AAAGCTTCTAACACCAGCCTGGG - Intergenic
902754527 1:18540330-18540352 GAGGCCTCTCTCACCAGCTTGGG - Intergenic
908754366 1:67454589-67454611 TAGACCTCTCTCACCAACCAAGG - Intergenic
913611186 1:120511223-120511245 GAGGCTGTTCTCACCATCCTTGG + Intergenic
914580005 1:149011016-149011038 GAGGCTGTTCTCACCATCCTTGG - Intronic
917527394 1:175801009-175801031 AATGCTTCTCTAAGCAAGCTGGG + Intergenic
918259449 1:182782405-182782427 GAGGCTTCTCTCCACAACTTAGG + Intergenic
1066380435 10:34896625-34896647 GAGGCTTTTCCCACCACCCTGGG - Intergenic
1071980278 10:90998465-90998487 AAGGCTTCTCCCTGTAACCTTGG - Intergenic
1074987209 10:118669008-118669030 AAGGGCTCTGTCCCCAACCTGGG - Intergenic
1075652650 10:124139370-124139392 AAACCTTCCCTCACCATCCTGGG - Intergenic
1075666219 10:124232927-124232949 AAGGATTGTCACACCACCCTGGG + Intergenic
1077235416 11:1479827-1479849 AAGGCTGCTTTCAGCAACCCAGG + Intronic
1077718494 11:4604413-4604435 AAGTCATCTCTGACAAACCTGGG - Intronic
1081521336 11:43884533-43884555 AAAGCATCTCTCACCAACTTTGG - Intronic
1082787025 11:57322850-57322872 TGGGCTTCACTCACCAGCCTAGG + Intronic
1085956129 11:81397855-81397877 AAGGCTTCTCTGTCCAACTAGGG - Intergenic
1087981117 11:104615882-104615904 AAGTCTTCTCCGACCACCCTTGG + Intergenic
1088322578 11:108568885-108568907 CAGGCTTCACTCACCACCCATGG + Intronic
1092022981 12:5217441-5217463 AAGACTTCTCTAACACACCTTGG + Intergenic
1096718448 12:53504635-53504657 AAGGCTTCTCACACCCACGCTGG - Intronic
1097591463 12:61580791-61580813 AATGTTTCTCTCAAAAACCTGGG + Intergenic
1099127760 12:78787001-78787023 AAAGCTTCTCTCACAAATATGGG + Intergenic
1099747242 12:86721017-86721039 AAAGTTTCTCTCACCAACTTGGG - Intronic
1102243166 12:111338232-111338254 TAGGCTTCTCTGCCCAGCCTCGG + Intronic
1105842441 13:24266425-24266447 AAGGCATGTGTCACCAAGCTGGG + Intronic
1106775819 13:33008589-33008611 AAGGCTTCTGTCTAGAACCTGGG - Intergenic
1109449028 13:62484184-62484206 TTGGCTTCTCTTACTAACCTAGG - Intergenic
1117102914 14:52368947-52368969 ATGTCTTCTGTCACCAACCAAGG - Intergenic
1119709944 14:76814347-76814369 AAGGCTTCCCTGAACAACCAAGG - Intronic
1121099938 14:91243556-91243578 AAGGCCTCTCTGACTAAGCTAGG + Intronic
1202902274 14_GL000194v1_random:50725-50747 CAGGCTCCTCTCCCCACCCTGGG - Intergenic
1126526222 15:49657410-49657432 AAGGCTTCTCTTACCTGGCTGGG - Intergenic
1127454196 15:59142754-59142776 AAGGGTCCTCTCCCCAACCAGGG - Intronic
1128805274 15:70526370-70526392 AAGGGTTCTGACTCCAACCTGGG - Intergenic
1131209236 15:90479445-90479467 AGGGCTTATCTCACCAGCCATGG + Intronic
1134404202 16:13940819-13940841 AAGGCTTCTCTCCTCAACACTGG - Intronic
1135123202 16:19784676-19784698 AGGGCTTCTATCTCCAAACTGGG + Intronic
1135351570 16:21733734-21733756 AAGGGTTGTCTCAACATCCTGGG - Intronic
1135450053 16:22549861-22549883 AAGGGTTGTCTCAACATCCTGGG - Intergenic
1135918726 16:26628822-26628844 AAGACTTCTTTCACTGACCTAGG - Intergenic
1136000779 16:27291166-27291188 AAGGAATGTCTCACCGACCTTGG - Intergenic
1138948406 16:61880567-61880589 AAGTCATTTCTCACCATCCTAGG - Intronic
1142169901 16:88616259-88616281 ACAGCTGCTCTCACCAAACTGGG + Intronic
1144750105 17:17642649-17642671 AGGCCTTCTCTGACCACCCTGGG + Intergenic
1147228570 17:39000678-39000700 AAGCCTTCTCTGACCAGCCTGGG + Intergenic
1148598521 17:48876372-48876394 CAGGCTGGTCTCACCCACCTCGG + Intergenic
1157716326 18:49890105-49890127 AAGCATTCTCTCACCCACCTGGG - Intronic
1158369297 18:56780583-56780605 CAGGCTGGTCTCACCCACCTGGG - Intronic
1158442464 18:57489112-57489134 AAGGCTTCTTCCTCCATCCTGGG + Exonic
1158616046 18:58987932-58987954 AAGCCTACTCCCACCACCCTAGG - Intergenic
1165414842 19:35686522-35686544 AAAGCTTCTCGCCCCACCCTGGG + Intergenic
1166321745 19:42023017-42023039 GTGCCATCTCTCACCAACCTTGG - Intronic
1166907839 19:46125730-46125752 AAGGCTGCTCTCCCCTACCCCGG + Intergenic
1168138336 19:54366829-54366851 ATGGCTTCTTGTACCAACCTAGG + Intronic
925589702 2:5497313-5497335 ATGGCTTCTCTCAGGACCCTGGG + Intergenic
925903837 2:8527370-8527392 CAGGCTTCTCTGAGCACCCTGGG - Intergenic
926972470 2:18480536-18480558 AAGGCTTGTATGCCCAACCTGGG - Intergenic
927870100 2:26617927-26617949 CAGGCTTCCCTCCCCAGCCTAGG - Intronic
929433895 2:41912319-41912341 AAGGGTTCTTTCCCCACCCTGGG + Intergenic
929668956 2:43854178-43854200 CAGGAACCTCTCACCAACCTGGG + Intronic
929990370 2:46781488-46781510 GAGGCTGCTTTCCCCAACCTTGG + Intergenic
930888911 2:56360450-56360472 AAGACATCTCTAACCAGCCTCGG + Intronic
931964870 2:67522231-67522253 AAGGCTTTTCTCCCCAACCTTGG - Intergenic
933015684 2:77123820-77123842 AAGGCTTCTCCCATTATCCTTGG + Intronic
933107336 2:78347502-78347524 AAGGCTTGAGTCACCAACCATGG - Intergenic
938841965 2:135172911-135172933 ATGGCTCCTATAACCAACCTTGG - Intronic
941506098 2:166347545-166347567 AAGGCTTTCCTCCCCAACCAGGG - Intronic
942965273 2:181885103-181885125 AAAAATTCTCTCACCAATCTAGG - Intergenic
942968856 2:181932126-181932148 TAGGCTTCTCTGACCACCCCAGG - Intergenic
944340775 2:198595927-198595949 AAGGCTTCACTCAAGAGCCTTGG - Intergenic
949061080 2:241957745-241957767 AAGGCTTCTCTCCTCAAGCCTGG - Intergenic
1175468131 20:59206950-59206972 TAGACTTCGCACACCAACCTGGG + Exonic
1176334679 21:5584971-5584993 AAGCCTACTCACACCAACCATGG - Intergenic
1176362502 21:6009749-6009771 AAGGCAACTCTCACCAATCATGG - Intergenic
1176393078 21:6235977-6235999 AAGCCTACTCACACCAACCATGG + Intergenic
1176468341 21:7080197-7080219 AAGCCTACTCACACCAACCATGG - Intronic
1176491902 21:7461975-7461997 AAGCCTACTCACACCAACCATGG - Intergenic
1176508740 21:7676408-7676430 AAGCCTACTCACACCAACCATGG + Intergenic
1176621642 21:9065492-9065514 CAGGCTCCTCTCCCCACCCTGGG - Intergenic
1178771983 21:35513757-35513779 AAGCCCTCCCTGACCAACCTTGG - Intronic
1179761016 21:43528796-43528818 AAGGCAACTCTCACCAATCATGG + Intergenic
1183375417 22:37462016-37462038 GAGGCTTCTCTCACCAGCCAGGG + Intergenic
1183599665 22:38832613-38832635 TAGGCTGCTCTCAACAGCCTGGG + Intronic
950529802 3:13546707-13546729 AAGGCTTCTCTTCCCAATCCAGG + Intergenic
952314154 3:32218164-32218186 AAAGATTCTCTCACTAAGCTGGG - Intergenic
952990682 3:38828585-38828607 AAGCATTCTCCCACCAAGCTTGG + Intergenic
953128051 3:40110611-40110633 GAGGCTTCTCCTACCAACCACGG + Intronic
953132181 3:40150706-40150728 ATGGCTTCTTTCACCTATCTGGG + Intronic
954218523 3:49138041-49138063 CAGGCTGCTCCCTCCAACCTGGG - Intergenic
954934713 3:54315713-54315735 AAAGCTTCTGGCACCATCCTGGG + Intronic
954934719 3:54315752-54315774 AAAGCTTCTGGCACCATCCTGGG + Intronic
958430846 3:94039157-94039179 AAGTCTTCTCTTACAAAACTAGG - Intronic
961151161 3:124639254-124639276 AGGGCTTCTCTGACCAGCCCAGG + Intronic
961335536 3:126176787-126176809 ATGTCTTCTCTCCCCAACCATGG - Intronic
962413329 3:135160777-135160799 AAGGCTTCTTTCACCAGTCTGGG - Intronic
966851704 3:184168838-184168860 AAGGCTACTCCCACCAATGTTGG - Intronic
967085386 3:186090682-186090704 AAGGCAGCTATCACCAACCTGGG + Intronic
972545157 4:40073173-40073195 AAGGTTTCTCTCATCAACTAAGG + Intronic
972666781 4:41172414-41172436 AAGGCTTCTCTCACCAACCTCGG + Intronic
976776994 4:88718183-88718205 AAGGCTCCACTCACGCACCTGGG + Intergenic
985004212 4:185516791-185516813 AGCATTTCTCTCACCAACCTTGG + Intronic
985872100 5:2565204-2565226 AAGGGTTCTCTGAGCAAGCTTGG - Intergenic
987304635 5:16625731-16625753 ATGCCTTCTCTTTCCAACCTTGG + Intergenic
987916442 5:24220843-24220865 AAGGCTTCTCTCAGGACCTTGGG + Intergenic
992449585 5:76863883-76863905 AAGGCTTCTTTCACATACTTAGG - Intronic
993960046 5:94286757-94286779 AAAGCTTCTGTTACCAGCCTGGG - Intronic
997091221 5:130860969-130860991 AAATCTTGTCTCACCAGCCTAGG + Intergenic
998506729 5:142678435-142678457 AAGGCTGCAAACACCAACCTGGG + Intronic
1000780698 5:165476968-165476990 AAGTCATTTCTCACCAGCCTTGG - Intergenic
1002884668 6:1282841-1282863 AAGGCTGCACCCACCCACCTGGG + Intergenic
1004176094 6:13341471-13341493 AAGGCTTCTCTTCCCAATCCTGG + Intergenic
1005930573 6:30481249-30481271 GAGGCTGCGCTCACCACCCTGGG - Intergenic
1006922147 6:37634086-37634108 CAGGCTTCACTCAGCACCCTAGG + Exonic
1017763007 6:157585593-157585615 AGGGCTTCACATACCAACCTTGG - Intronic
1019156361 6:170041574-170041596 AATGCTTCTCACACCTTCCTGGG - Intergenic
1019719513 7:2559621-2559643 AAGCCTCCTCTGACCAAGCTGGG - Intronic
1019964921 7:4490876-4490898 AAGCCTTTTCTCACCCACCCAGG + Intergenic
1021958675 7:25852127-25852149 ATGGCTAATCTCACCAACCCTGG + Intergenic
1022523349 7:31021921-31021943 ATGGATTCTCTCACCATCCATGG - Intergenic
1022585544 7:31605218-31605240 AAGGCTTCTATCAACTACCTTGG - Intronic
1023022364 7:36021758-36021780 AAGGTTTCTCTCCCCACCTTTGG - Intergenic
1024122633 7:46260601-46260623 GAGGCTTTTCTTACCAACCCTGG - Intergenic
1025121271 7:56305987-56306009 AAAGTTTCTCAGACCAACCTTGG + Intergenic
1030782877 7:113623690-113623712 AAGGCATCACTCACCCACTTTGG - Intergenic
1031641313 7:124167934-124167956 CAGGCTTCTCTCCCCAATTTTGG - Intergenic
1033567659 7:142595227-142595249 ACAGCTTCTCTCACCACTCTTGG - Intergenic
1033988093 7:147250920-147250942 TGAGCTTCTCTTACCAACCTTGG + Intronic
1037768461 8:21785762-21785784 AAGGCCTCTCTCTCCACCATGGG + Intronic
1038150540 8:24939410-24939432 AAAGCTTCCCTGACCAACCAAGG + Intergenic
1040518398 8:48153474-48153496 AAGCCTGCTCTCTCCAACCAAGG + Intergenic
1040700276 8:50055215-50055237 AAGTATTCTCTCACCAACTTGGG - Intronic
1042930935 8:74013628-74013650 AAGGCTTGTCTGACCAGCCTGGG - Intronic
1045217507 8:100163004-100163026 TAAGCTTATCTCACCAGCCTAGG + Intronic
1047406309 8:124588562-124588584 AAGACTTGTCTCACCGACCTGGG + Intronic
1048201382 8:132377125-132377147 TAGACTTCCCTCACCAACATGGG + Intronic
1049254295 8:141605579-141605601 GAGGCTTCTCTCAGCAAACAGGG + Intergenic
1052761185 9:32593350-32593372 AAAGATTCTCTCAGCAAACTAGG + Intergenic
1054725104 9:68642182-68642204 AAGGCTCCTTTCACCAAACAAGG - Intergenic
1057912098 9:99027123-99027145 ATGGCTTATCTCATCAAGCTGGG - Intronic
1058633191 9:107010106-107010128 AAGTATGCTCTCACCTACCTGGG - Intronic
1058958322 9:109969688-109969710 AAGGCTCCTGTCTCCAAGCTTGG - Intronic
1060126888 9:121055879-121055901 AAGGCATCTCTCTCCAGGCTTGG - Intergenic
1060214381 9:121729924-121729946 AAGGCTCCTCCCAGCAACCTTGG + Intronic
1062606601 9:137351304-137351326 AGGGCTTCACTCACCCAGCTTGG + Exonic
1203744826 Un_GL000218v1:35902-35924 CAGGCTCCTCTCCCCACCCTGGG - Intergenic
1203565278 Un_KI270744v1:83582-83604 CAGGCTCCTCTCCCCACCCTGGG + Intergenic
1188650843 X:32630809-32630831 AAGGCATCGCTGACCAATCTTGG - Intronic
1195564784 X:106327723-106327745 GAGGCTTCTCGCTCCCACCTGGG + Intergenic
1195864083 X:109410744-109410766 AAGCCTTCTCTGACTACCCTAGG - Intronic
1195937928 X:110143017-110143039 CAGGCTGCTCTCCCCAACCAAGG - Intronic
1196891982 X:120300091-120300113 AAGGCTTGTCTCACTATCCAGGG + Intronic
1199506414 X:148566869-148566891 AAGGTGTCTCTGACCACCCTTGG + Intronic
1201158164 Y:11150945-11150967 CAGGCTCCTCTCCCCACCCTGGG - Intergenic