ID: 972678151

View in Genome Browser
Species Human (GRCh38)
Location 4:41280093-41280115
Sequence CCTGGAAGGCGGAAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972678151_972678160 3 Left 972678151 4:41280093-41280115 CCTTCCACCTTCCGCCTTCCAGG No data
Right 972678160 4:41280119-41280141 CACAGCTCTGGTTGACAGCTTGG No data
972678151_972678158 -9 Left 972678151 4:41280093-41280115 CCTTCCACCTTCCGCCTTCCAGG No data
Right 972678158 4:41280107-41280129 CCTTCCAGGCGGCACAGCTCTGG No data
972678151_972678161 4 Left 972678151 4:41280093-41280115 CCTTCCACCTTCCGCCTTCCAGG No data
Right 972678161 4:41280120-41280142 ACAGCTCTGGTTGACAGCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972678151 Original CRISPR CCTGGAAGGCGGAAGGTGGA AGG (reversed) Intergenic
No off target data available for this crispr