ID: 972679946

View in Genome Browser
Species Human (GRCh38)
Location 4:41295681-41295703
Sequence CACAGCCGCCAAGTTTCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972679946_972679954 25 Left 972679946 4:41295681-41295703 CCCCTGGAAACTTGGCGGCTGTG No data
Right 972679954 4:41295729-41295751 ACTGTTTATCCCAGACATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972679946 Original CRISPR CACAGCCGCCAAGTTTCCAG GGG (reversed) Intergenic
No off target data available for this crispr