ID: 972689273

View in Genome Browser
Species Human (GRCh38)
Location 4:41381101-41381123
Sequence ATTCAGTGCCTGGCATTCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 373
Summary {0: 1, 1: 0, 2: 5, 3: 42, 4: 325}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972689273 Original CRISPR ATTCAGTGCCTGGCATTCAG TGG (reversed) Intronic
900667037 1:3822537-3822559 ATTCGCTGCCTGGCATAAAGAGG + Intronic
901067398 1:6500764-6500786 AGGCAGTGTCTGGCATGCAGTGG - Intronic
903388245 1:22944104-22944126 ATTCAGTACCTGGGATTCAAGGG + Intergenic
903585572 1:24413331-24413353 CTTCAGTGCCTGGCAGTGGGTGG - Intronic
904070129 1:27789100-27789122 ATATAGTGCCTGGCACTTAGAGG + Intronic
904141748 1:28358867-28358889 AGACAGTGCCTGGCATGGAGTGG - Intergenic
904207075 1:28862420-28862442 CTGCAATGACTGGCATTCAGTGG + Intronic
906746949 1:48228727-48228749 ATGCAGTGCCTGGCATACAGTGG + Intronic
907175795 1:52521210-52521232 GTTCAGTTCCTGGCATGTAGTGG + Intronic
907824902 1:58006152-58006174 GTTCAGTGCCTGGCATCCAGAGG + Intronic
907898847 1:58719088-58719110 GTTCAGGGCCTGGCATTCAAGGG - Intergenic
910424959 1:87112463-87112485 GTGCAGTGCCTGGCAAACAGTGG - Intronic
910436193 1:87208564-87208586 ATACAGTGCCTGGCACACACCGG + Intergenic
910634502 1:89392234-89392256 ATGCAGTGCCTGGCATTTAGTGG - Intergenic
911440460 1:97920581-97920603 CTTCAGTCACTGACATTCAGAGG + Intronic
912719810 1:112010683-112010705 AAGCAGTGACTGGCATACAGTGG - Intergenic
913209976 1:116574088-116574110 ATTCTGAACCTGGCTTTCAGGGG + Intergenic
917143299 1:171859580-171859602 AGACAGTGCCTGGCACACAGTGG - Intronic
917819997 1:178753094-178753116 ATTCAGTGCCTCGTATTCAGTGG - Intronic
918346248 1:183609958-183609980 ATTCAGTTCCAGGCATTCTTAGG + Intergenic
918506937 1:185265732-185265754 ATTCAGTCCCTTGTATTTAGTGG + Intronic
919060486 1:192625982-192626004 AATTAGTGCATGGCCTTCAGTGG - Intergenic
919777400 1:201203187-201203209 AAACAGTGCCTGGCACACAGTGG + Intronic
920939800 1:210471040-210471062 CCTCAGTGCCCAGCATTCAGTGG + Intronic
921315336 1:213885125-213885147 GCTCAGTGCCTGGCACACAGTGG - Intergenic
921365280 1:214367890-214367912 ATCCAGTGCCTGGCACGTAGTGG + Intronic
924691295 1:246353802-246353824 ATACAGTGCCTGGCACACAGTGG + Intronic
1063636824 10:7789642-7789664 GGACAGTGCCTGGCATGCAGTGG + Intronic
1063980033 10:11445383-11445405 GCACAGTGCCTGGCATACAGGGG + Intergenic
1064264189 10:13811694-13811716 CTTCAGTGCCTGGTGTTCTGTGG - Intronic
1067148904 10:43713448-43713470 CTCCAGTGCCTGGCACACAGAGG + Intergenic
1067563579 10:47321227-47321249 ATTCAGGCCCAGCCATTCAGGGG + Intergenic
1067781661 10:49212016-49212038 GCTCAGTGCCTGTCACTCAGTGG - Intergenic
1067795788 10:49320654-49320676 ATACAGTGCCTGAAGTTCAGTGG - Intronic
1068420199 10:56781183-56781205 ACTTAGTGCCTGGCACACAGCGG - Intergenic
1068585236 10:58790930-58790952 ATTCAGTGCTTGACCTTTAGTGG + Intronic
1069175250 10:65282250-65282272 ATTCAGTCCCTTGTATTTAGAGG + Intergenic
1069930447 10:71878097-71878119 GCTCAGTGCCTGGCACTGAGGGG - Intergenic
1070344063 10:75524508-75524530 ATACAGTGCCTGGCATACATAGG + Intronic
1071837566 10:89434338-89434360 ATTCAGTTCGTGGCCTTCATTGG - Intronic
1073559588 10:104485528-104485550 GATCAGTGCCTGGCATAAAGTGG + Intergenic
1073559738 10:104486645-104486667 GCTCAGTGCCTGGAATACAGTGG - Intergenic
1074234966 10:111576007-111576029 ATGCAGTGACTGGCATTTTGGGG - Intergenic
1074595331 10:114859357-114859379 AGTCAATCTCTGGCATTCAGTGG - Intronic
1076161232 10:128245669-128245691 TGTCAGTGCGTGGCCTTCAGAGG - Intergenic
1080107657 11:28527464-28527486 ATACTGTGCCTGGCATGCAGGGG - Intergenic
1080123092 11:28699937-28699959 ATTCAGTACCTTGCCTTCAGAGG + Intergenic
1080888046 11:36384452-36384474 ACTCAGATCCTGGCATCCAGTGG + Intronic
1081183328 11:40012032-40012054 ATTCACTCCCTGTCATTTAGTGG - Intergenic
1081659887 11:44881640-44881662 GAACAGTGCCTGGCATACAGCGG - Intronic
1081931572 11:46875210-46875232 ATTCAGTGCCTGGCAGGGTGAGG + Intronic
1083985074 11:66209068-66209090 ATTCAGTAACTGGCAGTAAGAGG + Intronic
1084408554 11:68992812-68992834 AATCAGGGGCTGGCATACAGTGG + Intergenic
1084433083 11:69122347-69122369 ACCCAGTGCCTGGCACACAGCGG + Intergenic
1085215105 11:74822881-74822903 ACACAGTGCCTGGCATACAGTGG - Intronic
1085294788 11:75425324-75425346 ATTCTGCGCCTGGCACACAGTGG + Intronic
1085426471 11:76409087-76409109 GCACAGTGCCTGGCATGCAGCGG - Intronic
1085811796 11:79689738-79689760 GTTCAGTGCCAGTCATTGAGAGG - Intergenic
1087507358 11:99042731-99042753 GTACAATGCCTGGAATTCAGTGG + Intronic
1088796619 11:113271030-113271052 ATACAGTGCCTGGCATGTGGTGG - Intronic
1089139508 11:116274677-116274699 ACCCAGGGCCTGGCATTCACTGG + Intergenic
1089812523 11:121143625-121143647 GCACAGTGCCTGGCACTCAGTGG + Intronic
1089907386 11:122054812-122054834 AGTCAGTGTCTGTCATTTAGGGG + Intergenic
1092024926 12:5232375-5232397 GTGCAGTGCCTGGCCCTCAGGGG + Intergenic
1093043279 12:14410801-14410823 ATCCAGTTTCAGGCATTCAGTGG + Intronic
1093223539 12:16452346-16452368 ATTCACTTCCTTGTATTCAGAGG + Intronic
1093640250 12:21519630-21519652 CTCCAGTTCCTGGCATTTAGTGG + Intergenic
1094775077 12:33717302-33717324 ATTCAGTGCCTGCCATTCTCAGG + Intergenic
1096756353 12:53803020-53803042 ATTCAGAGCATGGCAGTCTGAGG + Intergenic
1098100051 12:67005661-67005683 GTGCAGTGCCTGGCACTCAGTGG - Intergenic
1098463402 12:70759268-70759290 ATTTAGTGCCTGGCATGCAATGG - Intronic
1098510507 12:71308198-71308220 ATTGATTGGTTGGCATTCAGAGG - Intronic
1098556688 12:71826464-71826486 ACTCAATCCCTGGCTTTCAGTGG - Intergenic
1099126384 12:78763171-78763193 ATTGGGTGCCAGGCATTCGGGGG - Intergenic
1099579714 12:84428743-84428765 ATTCAGTGCCTCAAACTCAGTGG - Intergenic
1099918622 12:88928271-88928293 ATTCAGTGCCTTGTACTTAGTGG + Intergenic
1101993112 12:109503955-109503977 CCTCAGTGCCTGGCACACAGGGG - Intronic
1102183601 12:110931436-110931458 TCTCGGTGCCTGGCATTCCGGGG + Intergenic
1102431701 12:112889158-112889180 ATTCTGAGCCTGGAATTCAGTGG - Intronic
1102525721 12:113511260-113511282 CCCCAGTGCCTAGCATTCAGCGG + Intergenic
1103174448 12:118850159-118850181 GTACAGTGCCTGGCATATAGTGG + Intergenic
1103778836 12:123385892-123385914 ATAAAGTGCCTGGCCCTCAGTGG - Intronic
1108411153 13:50148466-50148488 ACTCAGTGCCTTTCAATCAGTGG + Intronic
1113922304 13:113919941-113919963 ACTCAGTGCCTGGCACACTGGGG - Intergenic
1117330958 14:54711634-54711656 ATTCAGTGCCTGGATTTTGGAGG + Intronic
1118372712 14:65151418-65151440 ATTCAGTTAATGGAATTCAGTGG + Intergenic
1118491376 14:66263862-66263884 ATTCTTTGCCTGGGTTTCAGAGG - Intergenic
1119457169 14:74765847-74765869 ATTCAGTGCCTGCAATTCTTTGG + Intronic
1119891285 14:78184256-78184278 TTCCAGTGCCTGGCATCGAGCGG - Intergenic
1120073397 14:80128065-80128087 ATTCAGAGCATGGTATTAAGTGG + Intergenic
1121229430 14:92345801-92345823 TCCCAGTGCCTGGCATACAGGGG - Intronic
1121618623 14:95331128-95331150 ACTCAGTGCCTTCCATTCAGTGG + Intergenic
1122003587 14:98684343-98684365 ATTCGGAGCCTGCCATTCAAAGG - Intergenic
1123036136 14:105472743-105472765 ATTCTGGGCCTGGCAGGCAGGGG - Intergenic
1124427333 15:29572699-29572721 CTTCAGTGCCTGGCACATAGTGG - Intergenic
1124610739 15:31206750-31206772 ATTCTGTGGCTTGCAGTCAGTGG - Intergenic
1125735769 15:41924561-41924583 ATCCAGTGCCTGGCATACAGGGG + Intronic
1126691580 15:51292905-51292927 ATTCTCTGCTTGGCATTGAGGGG + Intronic
1127647167 15:60970428-60970450 ATACAATGCCTGGCACGCAGTGG - Intronic
1128192588 15:65717193-65717215 ATCCAATGCCTAGCATTCGGAGG + Intronic
1128354483 15:66915289-66915311 GCTCAGTGCCAGGCACTCAGAGG - Intergenic
1128707352 15:69846594-69846616 ATGCAGTGCCTGGCATATAGTGG + Intergenic
1129106317 15:73309782-73309804 CCTCAGTGCCTGGCATATAGTGG - Intergenic
1129481396 15:75829446-75829468 ATTCAGAGCCTGGCAAGCTGTGG + Intergenic
1129514600 15:76149405-76149427 ATACAGTGCCTAGCATTTGGTGG + Intronic
1129704178 15:77785169-77785191 ACTCAGGGCCTGGCACACAGTGG + Intronic
1130067740 15:80618724-80618746 ATTCAGTGCTTAGCACTCTGTGG + Intergenic
1130903855 15:88226424-88226446 CTTCAGTGCCTGGCCTTCCCCGG - Intronic
1131069336 15:89455597-89455619 ATTCAGTTCCTTGCATTTACAGG + Intergenic
1131298428 15:91172906-91172928 AGTAAGAGCCTGGCTTTCAGGGG + Intronic
1131624590 15:94104162-94104184 ATTGAATTCCAGGCATTCAGAGG - Intergenic
1132093583 15:98965681-98965703 ACCGAGTGCCTGGCACTCAGGGG + Intergenic
1133003472 16:2863587-2863609 CTTCAGTGCCTGTCAGTTAGTGG + Intergenic
1133139834 16:3735621-3735643 CTGCACTGCCTGGCACTCAGGGG + Intronic
1133152960 16:3850639-3850661 ATTCAGTGCTTGGGAGGCAGCGG + Exonic
1133367808 16:5224884-5224906 ATTCAGTGCCTGGTACACATAGG - Intergenic
1133477597 16:6138461-6138483 ATTCAGTTCCTTGCAGTCATAGG + Intronic
1134528926 16:14967149-14967171 ATCCAGTGCCTAGGATGCAGTGG - Intergenic
1134677227 16:16099205-16099227 ATGAAGTGCCTGGCACACAGTGG + Intronic
1135100452 16:19600591-19600613 GATCAGTGCCTGGCACACAGGGG - Intronic
1137236923 16:46624597-46624619 AGACAGTGCCTGGCACTGAGGGG - Intergenic
1138310612 16:56020437-56020459 ACCCATTGCCTGGCATTGAGAGG - Intergenic
1138415254 16:56867941-56867963 ATCCAGAGCCTGGCATTTACAGG - Intronic
1139024878 16:62804375-62804397 ATTCAGTGCTTGCCAATGAGAGG + Intergenic
1139241192 16:65393987-65394009 ATGCAGAGCCTGGGATTCATAGG - Intergenic
1139657325 16:68396946-68396968 ACACAGTGCCTGGCACACAGTGG - Intronic
1139867440 16:70073829-70073851 ATCCAGTGCCTAGGATGCAGTGG + Intergenic
1140746268 16:77983067-77983089 ATTCCCAGCTTGGCATTCAGCGG - Intergenic
1141008075 16:80371791-80371813 ACACAGTGCCTGGAATGCAGTGG + Intergenic
1141409763 16:83825077-83825099 GCACAGTTCCTGGCATTCAGTGG - Intergenic
1141975803 16:87515709-87515731 ATGCAGAGCCTGGCATCCAGAGG + Intergenic
1143019463 17:3909353-3909375 GCACAGTGCCTGGCACTCAGTGG + Intronic
1144489494 17:15696316-15696338 AAACAGTGCCTGGCATTTTGTGG - Intergenic
1144911474 17:18685642-18685664 AAACAGTGCCTGGCATTTTGTGG + Intergenic
1147246865 17:39127418-39127440 ATTCAGGGCCTAGCACACAGTGG - Intronic
1148137630 17:45304964-45304986 GCACAGTGCCTGGCATGCAGTGG + Intronic
1148713155 17:49696581-49696603 ATTCAGTGCCTTCCACTCTGTGG - Intergenic
1148739533 17:49884673-49884695 GCACAGTGCCTGGCAGTCAGCGG + Intergenic
1148990470 17:51661751-51661773 ATTCAGTGTCTGGAACACAGTGG - Intronic
1150497078 17:65616196-65616218 AATCAGTGCCTGACACACAGAGG + Intronic
1151889881 17:76945791-76945813 GCACAGTGCCTGGCATACAGTGG - Intronic
1155911210 18:31506117-31506139 ATCCAGTGACTGGCACACAGCGG - Intronic
1157056819 18:44239187-44239209 ATCCAGTGCCTGGCATTTAAAGG + Intergenic
1157290933 18:46409098-46409120 TAACAGTGCCTGGCATACAGGGG + Intronic
1157500290 18:48185760-48185782 ATTCAGTGCCTTACATTCCTGGG + Intronic
1157727680 18:49977531-49977553 ATTCTGTGCCTGGCACTGTGAGG + Intronic
1158545621 18:58393887-58393909 ATTGAGTGTCTGACATTCAAAGG + Intronic
1158776919 18:60593969-60593991 ATTCAATCCCTGGCTTTCAGGGG - Intergenic
1159941480 18:74412194-74412216 ATTCAGAGTCTGCCATTCATTGG + Intergenic
1160126260 18:76175147-76175169 AGACAGTGCCTGGCATCCAGTGG - Intergenic
1161028580 19:2047783-2047805 ATTCAGTGCCTGGTGCTCTGGGG + Intronic
1161548662 19:4898158-4898180 CTTCAGTGCATGGTATACAGTGG + Intronic
1162831522 19:13287415-13287437 CTGCAGTGCCTGGAATTGAGAGG + Intronic
1162947674 19:14053752-14053774 AAGCAGTGGCTGGCATTCGGCGG + Exonic
1163735803 19:18979835-18979857 GCTCAGTGCCTGGCACACAGTGG - Intergenic
1164836241 19:31356969-31356991 ATTCAGTGCCTGGAGTTGCGGGG + Intergenic
1164870556 19:31639997-31640019 ATTCACTGCCTGGCACCCAATGG - Intergenic
1164953072 19:32355358-32355380 ACTGAATGCCTGGCATTCTGGGG - Intronic
1165752691 19:38270394-38270416 AGTCAGTGCCTGGCAATTGGTGG - Intronic
1165990245 19:39807160-39807182 ATTCAGTGGCTGGGATACTGAGG - Intergenic
1166992058 19:46698498-46698520 GTACAGTGCCTGGCATACAGAGG + Intronic
1167194680 19:48019954-48019976 ACTCAGTGCCTGGCTCACAGTGG - Intronic
925632839 2:5913218-5913240 CTTCAGTGCCTGGCATGGAGTGG - Intergenic
925755600 2:7128739-7128761 GTACAGTGTCTGGCATACAGAGG - Intergenic
928085800 2:28345561-28345583 CACCAGTGCCTGGCACTCAGTGG + Intergenic
928249255 2:29660462-29660484 GTTGAGTGACTGGCATCCAGGGG - Intronic
928298176 2:30103492-30103514 AACCAGTACCTGGCATTTAGTGG + Intergenic
928373008 2:30754770-30754792 AGTAAGTGCCTGGCTTTGAGAGG - Intronic
928723190 2:34143056-34143078 ATACAGTGTGTGGCATTGAGAGG - Intergenic
928723257 2:34143836-34143858 ATACAGTGCCTGGTATTTAGTGG - Intergenic
929077878 2:38093349-38093371 AAACAGTGCCTGGCACTTAGGGG - Intronic
930852786 2:55978701-55978723 TTTCATTGCCTGACATGCAGGGG + Intergenic
932157199 2:69428442-69428464 ATTCAGTGCCTATCATGCACTGG + Intronic
934038674 2:88109860-88109882 CTTAAGGGCCAGGCATTCAGAGG - Intronic
934772674 2:96917384-96917406 ATTCATTTCCTGGCATTTAAAGG + Intronic
935056397 2:99571132-99571154 ATTCAGTGCCATTCATTCAAGGG - Intronic
935782803 2:106522851-106522873 AATGATTGCCTGGGATTCAGTGG - Intergenic
935946982 2:108295689-108295711 AAGCAGTGCCTGACACTCAGAGG + Intronic
938179681 2:129169229-129169251 ATTCAGTCTGTGGCACTCAGAGG - Intergenic
940134880 2:150424991-150425013 ACACAGTGCCTGGCACACAGTGG - Intergenic
941935122 2:170975900-170975922 AGTCAGTGCCTGGCATGTGGTGG + Intergenic
945357913 2:208860651-208860673 TTTCACAGGCTGGCATTCAGTGG - Intergenic
945679900 2:212901628-212901650 ATTAATTGCCTGGGATACAGAGG + Intergenic
946320044 2:218947807-218947829 GTTCACTGCCTGGCATGTAGAGG + Intergenic
947222394 2:227805948-227805970 ATACAGTGCCTGGAATTTACAGG + Intergenic
947358340 2:229320242-229320264 ATTCAGTGCCTTCCATTCGATGG + Intergenic
948182374 2:235992407-235992429 TTTGAGTGTCTGGCGTTCAGTGG + Intronic
948659211 2:239496844-239496866 ATTGATTGGCTGGCTTTCAGAGG - Intergenic
948659246 2:239497084-239497106 ATTCATTGGCTGGCTTTCAGAGG - Intergenic
1168749926 20:275264-275286 ACATGGTGCCTGGCATTCAGAGG + Intronic
1168862039 20:1052538-1052560 GCTCAGTGCCTGGCACACAGTGG - Intergenic
1169696962 20:8400332-8400354 ATTATGTGCCTGGTAATCAGTGG - Intronic
1169810573 20:9605234-9605256 ATTCATTGCCTGGCATTTCTGGG + Intronic
1169854396 20:10087763-10087785 ATTTAGTGCCTGGCATACACTGG - Intergenic
1169876787 20:10306583-10306605 ATTCAGAGCCTGACACTCAAAGG - Exonic
1170533932 20:17321974-17321996 CTACAGTACCTGGCATTTAGAGG + Intronic
1170546526 20:17439525-17439547 TTACATTGCCTAGCATTCAGAGG - Intronic
1172062902 20:32199049-32199071 ATGCAGAGCCTGGCAAACAGTGG - Intronic
1172394046 20:34586652-34586674 ATGCAGAGCCTGGCACGCAGAGG + Intronic
1172757287 20:37294893-37294915 CACCAGTGTCTGGCATTCAGGGG + Intronic
1173413540 20:42836679-42836701 AGCCAGTGCCAGGAATTCAGTGG - Intronic
1173419900 20:42891762-42891784 ATACAGTGCCTGGCACACAGTGG - Intronic
1174403981 20:50292054-50292076 GCTCAGTGCCTGGCACTCAGTGG + Intergenic
1174830620 20:53808885-53808907 GTTCAGTGCCTGGCACAGAGTGG + Intergenic
1175606839 20:60318122-60318144 ACACAGTACCTGGCATGCAGTGG - Intergenic
1175808732 20:61845989-61846011 GTACAGAGCCTGGCCTTCAGGGG + Intronic
1176663119 21:9659444-9659466 ATTCAGTGCCTCCCATCAAGCGG + Intergenic
1177946130 21:27471766-27471788 AAGCAGTGCCTGTCATACAGAGG - Intergenic
1182129688 22:27841932-27841954 CTCCAGTGCCTGGCACACAGTGG - Intergenic
1182485053 22:30634569-30634591 ATTCAGCGCCTGGCCACCAGAGG + Intergenic
1182930926 22:34173756-34173778 ATTGAGAGCCTCGAATTCAGAGG + Intergenic
1183069088 22:35383829-35383851 AATCAGTACCTGGCATATAGTGG - Intronic
949669746 3:6385837-6385859 ATTCACTTCATGGCATCCAGAGG + Intergenic
949894281 3:8757847-8757869 ACTCAGTGCATGGCATGGAGGGG - Intronic
950681114 3:14585724-14585746 AGTCAGTGCCTGGTATGCAGTGG - Intergenic
950708287 3:14797331-14797353 AGAAAGTGCCTGGCATTTAGTGG - Intergenic
950738823 3:15033381-15033403 ACCCAGTGCCTGGCATGCAAGGG + Intronic
951670213 3:25173060-25173082 ATTCAGAGGTTGCCATTCAGTGG + Intergenic
952376589 3:32772787-32772809 CTTTAGTGCCTGGCACCCAGCGG + Intronic
952834796 3:37593705-37593727 ATTCAGTCCACGGCATCCAGTGG + Intronic
953414801 3:42709514-42709536 ATTCAGGGACTGGCCTTCAGAGG - Intronic
953647671 3:44769934-44769956 ATACAGTGCCTGTCATCCAGAGG - Intronic
955290856 3:57691362-57691384 ATGCAGTGCCTGGCACCTAGTGG - Intronic
955379999 3:58430702-58430724 GGTCAGTCCCTGGAATTCAGAGG - Exonic
955481296 3:59393245-59393267 GTACAGTGCCTGGCACACAGTGG - Intergenic
956662053 3:71608662-71608684 ACACAGTGCCTGGCACTGAGTGG + Intergenic
957029780 3:75227050-75227072 ATACAATGCCTGGAATGCAGTGG - Intergenic
957447018 3:80326134-80326156 ATTCCGTGCCTCACATCCAGGGG - Intergenic
957980019 3:87496983-87497005 TTTTAATGCCTGGCATACAGTGG - Intergenic
959766693 3:110039357-110039379 ATACAGTGCCTGGCATGTTGTGG - Intergenic
960317095 3:116191418-116191440 ATTCAGTATCTGGCATTCACGGG - Intronic
961143437 3:124574734-124574756 ATTCAGTGCATGTCATTCCTGGG - Intronic
961750042 3:129089294-129089316 AGACAGTGCCTGGCACTGAGGGG - Exonic
961804529 3:129479794-129479816 CTGCAGTGCCTGTCCTTCAGCGG + Exonic
961910988 3:130316389-130316411 ATTTATTGGCTGGCTTTCAGAGG + Intergenic
962650273 3:137481478-137481500 TCACAGTGCCTGGCATACAGTGG + Intergenic
963488564 3:145968647-145968669 TGTCAGTGCCTGGCATGCACAGG - Intergenic
965641612 3:170834784-170834806 ATACAGTGCCTGGCATGTTGTGG - Intronic
965932680 3:174065895-174065917 ATTCAGTTCCTTGCATGCTGTGG - Intronic
966152901 3:176884356-176884378 GCACAGTGCCTGGCATACAGTGG - Intergenic
966675492 3:182582958-182582980 ACACAGTGCCTGGTATACAGCGG - Intergenic
967879948 3:194294710-194294732 ATTCAGAGCCTGCCTGTCAGTGG - Intergenic
969038175 4:4272986-4273008 ATCCAGTCCCTGGCCTTCACGGG - Intronic
969990905 4:11261285-11261307 ATACAGTGCATGGCACTCATTGG - Intergenic
970511994 4:16790127-16790149 ACTCAGTGTCTGGTATTTAGTGG - Intronic
970561226 4:17284047-17284069 CTTCAGAGCCTGCCATGCAGTGG - Intergenic
971291847 4:25349947-25349969 AAACAGTGCCTGGCACACAGTGG - Intronic
972689273 4:41381101-41381123 ATTCAGTGCCTGGCATTCAGTGG - Intronic
975655919 4:76641223-76641245 CTTGAGTGCCTATCATTCAGTGG + Intronic
977654185 4:99503186-99503208 ACACAGGGCCTGGTATTCAGAGG + Intergenic
977963167 4:103108924-103108946 ATTCCGTTCCTTGCATTGAGAGG + Exonic
978136966 4:105274505-105274527 CTTCATTGCCTGGCATGCAATGG - Intronic
978541819 4:109824640-109824662 GTACAGTGCCTGGCACTCTGTGG + Exonic
979227744 4:118308810-118308832 GAACAGTGCCTGGCATACAGAGG + Intronic
980978607 4:139634595-139634617 ATTCCGTACCAGGCAGTCAGAGG + Intergenic
981815473 4:148826190-148826212 ATTTAATGACTGGCATTAAGTGG + Intergenic
984707057 4:182855320-182855342 GCTCAGTGCCTCGCATACAGTGG - Intergenic
985412202 4:189696596-189696618 ATTCAGTGCCTCCCATCAAGCGG - Intergenic
988335832 5:29908178-29908200 TTTCAGTTCCTGGCAGACAGTGG + Intergenic
988502066 5:31791859-31791881 ATTCAGTGCCTGGAAGTTGGGGG - Intronic
988687451 5:33538818-33538840 ATTCAGTGCCAGGGAAGCAGGGG - Intronic
988842561 5:35097301-35097323 AAACAGTGCCTGGCATGCAGTGG - Intronic
990326144 5:54677263-54677285 CTACAGTGCCTGGCATAAAGGGG + Intergenic
990994012 5:61713037-61713059 ATTCAGTGCCTCACTTGCAGAGG + Intronic
991229186 5:64311128-64311150 ATTGAATTCCTGGCATTAAGTGG - Intronic
992564653 5:77985584-77985606 CCTCATAGCCTGGCATTCAGGGG + Intergenic
993048407 5:82895592-82895614 ACTCAGTGCCTGGCATAGAGTGG - Intergenic
993536120 5:89088240-89088262 AAACAGAGCCTGGCATTCTGGGG - Intergenic
993875864 5:93306034-93306056 TTCCAGTGCCTGTAATTCAGAGG - Intergenic
993971058 5:94420447-94420469 ACTGAGTGCTTTGCATTCAGTGG - Intronic
995274842 5:110266410-110266432 AGTTAGTGCCTGGTATACAGAGG + Intergenic
997201398 5:132011905-132011927 CGTCAGTACCTGGCATTCTGCGG + Intronic
997416956 5:133736354-133736376 CTTCAGAGCCTGTGATTCAGAGG - Intergenic
997587104 5:135049918-135049940 ATTCAGTGTCTGGATTTCGGTGG + Intronic
997699300 5:135885264-135885286 ATCCAGTGCCAGGCATACAATGG + Intronic
997749312 5:136329308-136329330 TCTCAGTGCCTGGCATACAGTGG - Intronic
997870839 5:137504041-137504063 TCTCAGAACCTGGCATTCAGTGG + Intronic
999824621 5:155262240-155262262 ATTTAATGCCTGGAAATCAGGGG + Intergenic
1000003791 5:157164731-157164753 AATCAGTGCCTGGTAGTCACAGG + Intronic
1001117004 5:168948224-168948246 ATGCACTGCCTGGCACACAGTGG + Intronic
1001122502 5:168991940-168991962 AATCAGTGCCTGCCAGTCAGGGG - Intronic
1001772885 5:174309094-174309116 GTTCAGTGCCCAGCATTCAAAGG + Intergenic
1002191497 5:177480276-177480298 TGTCAGTGCCTGGCATATAGTGG - Intergenic
1002328349 5:178424756-178424778 ATTCAGTGTCTGTAACTCAGAGG - Intronic
1002878163 6:1229365-1229387 GTTCAGTGCCTGGCACATAGTGG - Intergenic
1003032541 6:2615032-2615054 ATTCAGTGCATGGAAAGCAGAGG - Intergenic
1004869551 6:19890839-19890861 AGTGAGTGCCTGGTATACAGTGG - Intergenic
1005889209 6:30122799-30122821 ATTTACTGCCTGGCTCTCAGTGG - Intergenic
1006402675 6:33826888-33826910 AATCAGAACCTGGCATTCATGGG + Intergenic
1006737189 6:36282620-36282642 ATACAGTGCCTGGCACTCACAGG - Intronic
1007840623 6:44713057-44713079 AATAAGAGGCTGGCATTCAGAGG + Intergenic
1009675815 6:66819212-66819234 ATTCAGTGCCTGTTATAAAGTGG - Intergenic
1011070942 6:83382284-83382306 GTAAAGTGCCTGGCATGCAGTGG + Intronic
1011762655 6:90586020-90586042 CTTCAGTACCTGGCATGTAGGGG - Intronic
1013163997 6:107573424-107573446 ATTCTGTGCCAGGCATTGTGTGG + Intronic
1013938627 6:115632544-115632566 ATTTAGAGGCTGGCAGTCAGGGG + Intergenic
1013962620 6:115918677-115918699 ATTAAGTGCCAGAGATTCAGTGG - Intergenic
1015919119 6:138248955-138248977 AGTGAATGCCTGGCATTCTGGGG + Intronic
1017540514 6:155397505-155397527 GAACAGTGCCTGGCATACAGTGG + Intronic
1021315108 7:19138880-19138902 ATTTTGTGCCTGGCATTATGTGG - Intergenic
1021450934 7:20783884-20783906 ATCCAGTGCCTGGTAGACAGCGG - Intronic
1021764443 7:23932727-23932749 GCACAGTGCCTGGCATACAGTGG - Intergenic
1022273562 7:28833989-28834011 AATCAGTGCCCTGAATTCAGTGG - Intergenic
1022798663 7:33753848-33753870 ACTATGTGCCTGGCATACAGGGG + Intergenic
1023214168 7:37843803-37843825 AATCAGTGCCTGGACTGCAGAGG + Intronic
1023560286 7:41466957-41466979 GTTCAGTGACTGACATTAAGTGG - Intergenic
1023660413 7:42466021-42466043 CTTCTCTGCCTGGCATTCAGTGG - Intergenic
1024193396 7:47035076-47035098 GTTCAGTGCCTGGCACATAGAGG - Intergenic
1024673707 7:51619531-51619553 ATTCAGTCTCAGGCATTCACTGG - Intergenic
1026029338 7:66776254-66776276 ATTCATTCCCCGGCCTTCAGGGG - Intronic
1026256556 7:68716943-68716965 CTTCAGTCCCTGGCATGCAGTGG + Intergenic
1026256903 7:68720144-68720166 CTTCAGTCCCTGGCATGCGGTGG + Intergenic
1026378288 7:69773923-69773945 AGTCAGTGCCTCATATTCAGTGG + Intronic
1027014765 7:74772797-74772819 ATCTAGTGCCTGGCACACAGAGG - Intergenic
1027073266 7:75173158-75173180 ATCTAGTGCCTGGCACACAGAGG + Intergenic
1027953495 7:84850473-84850495 ATTCAGTTCCTCGCATTCATAGG + Intergenic
1027977228 7:85174304-85174326 TTACAGTGCCTGGCATGCAGCGG + Intronic
1028618750 7:92800624-92800646 AGTAGGTGCCTTGCATTCAGGGG + Intronic
1030150303 7:106397959-106397981 ATCCAGTGACTGGCACTTAGGGG - Intergenic
1030670905 7:112335717-112335739 TTCCAGAGCCTGGCATACAGTGG - Intronic
1030830811 7:114218675-114218697 ATTCAGTGCTTGACACTCATTGG - Intronic
1031406169 7:121390164-121390186 ATTAAGTGCCTGGCAACCAGAGG - Intronic
1032228587 7:130054277-130054299 GTTGAGTGGCTGGCACTCAGAGG - Intergenic
1032961690 7:137042559-137042581 TTTCAGTTCTTGACATTCAGAGG + Intergenic
1033605737 7:142927369-142927391 GTGCAGTGCCTGACATACAGCGG + Intronic
1034478733 7:151303713-151303735 AGCCAGTGCCTGGCATGGAGTGG - Intergenic
1035268446 7:157705468-157705490 ACTCAGTTCCTGGCATTCTGGGG - Intronic
1036220019 8:6913755-6913777 ATTCAGTGGCTGATGTTCAGTGG - Intergenic
1037660685 8:20924055-20924077 AGGCAGAGCCTGGCATTAAGTGG + Intergenic
1037899943 8:22682202-22682224 ATTCAGATCCTGACAATCAGTGG - Intergenic
1038260705 8:25991394-25991416 GTTCAGTTCCTGGCATACAATGG - Intronic
1039635514 8:39160208-39160230 TTTCAGTGCCTGTCATCAAGAGG - Intronic
1039816249 8:41097073-41097095 ATTCAGTGCCTACCACTAAGGGG + Intergenic
1040978336 8:53218811-53218833 ATTCATTGTCTGGCTTTCTGTGG + Intergenic
1042029322 8:64458006-64458028 ATTCCCTGCCTGACACTCAGTGG + Intergenic
1042401631 8:68355471-68355493 ATTCTGTGACTGGCATTTGGTGG + Intronic
1042624442 8:70741433-70741455 ACCCAGTCCCTGGTATTCAGCGG + Intronic
1042726734 8:71887492-71887514 TTTCAGTGTCTGGCATTGAAGGG + Intronic
1044175924 8:89122121-89122143 ATTCAGTGCCTGGCATGTGTGGG + Intergenic
1044341231 8:91048562-91048584 TTTGAGTGCCTGCCATTGAGAGG + Intergenic
1046707283 8:117469020-117469042 AGACAGAGACTGGCATTCAGTGG - Intergenic
1047111683 8:121796602-121796624 ATTCAGTGCCCACCATGCAGTGG - Intergenic
1047586352 8:126278111-126278133 ATCAAAAGCCTGGCATTCAGTGG + Intergenic
1047664443 8:127075272-127075294 ATTAAGTGGCTGGCATGAAGAGG - Intergenic
1048025886 8:130586261-130586283 ACTCGGCGCATGGCATTCAGTGG + Intergenic
1048352765 8:133629431-133629453 ACTCAGTGACTGGCACTTAGCGG + Intergenic
1049045480 8:140148004-140148026 AGCCAGTGCCTGGCACACAGTGG - Intronic
1049469438 8:142768884-142768906 ATTCAGGGCCTGGGAGGCAGGGG + Intronic
1050259895 9:3829785-3829807 ATTCAAGGCCTGACCTTCAGGGG + Intronic
1051121471 9:13756773-13756795 ATTAAGTGCTTGGGACTCAGTGG + Intergenic
1051589402 9:18761029-18761051 ATACAGTGCCTAGCACTCAGTGG + Intronic
1056660231 9:88537764-88537786 GTTCAGTGCCTGGCATCCCCAGG + Intronic
1057839807 9:98477151-98477173 CTACAGTGCCTGGTATACAGGGG + Intronic
1057866802 9:98687809-98687831 ACACAGTGCCTGGCACACAGAGG + Intronic
1058933500 9:109745957-109745979 CTGCAGAGCTTGGCATTCAGAGG + Intronic
1059956728 9:119523644-119523666 ATGCTATGCCTTGCATTCAGAGG - Exonic
1060260657 9:122071117-122071139 ATCCAGTGCCTGGCTTAGAGTGG + Intronic
1060265153 9:122107785-122107807 AAGCAGTGCCTGGCACGCAGTGG - Intergenic
1203662980 Un_KI270753v1:62321-62343 ATTCAGTGCCTCCCATCAAGCGG - Intergenic
1203670392 Un_KI270755v1:6385-6407 ATTCAGTGCCTCCCATCAAGCGG + Intergenic
1185723463 X:2400558-2400580 ATTCAGTGCCTGAAACACAGTGG - Intronic
1187469111 X:19552728-19552750 AGTCAGTTCCTGGGATGCAGTGG - Intronic
1189222109 X:39381404-39381426 GTACAGTGCCTGGCACACAGTGG - Intergenic
1189278502 X:39804472-39804494 GTTCAGTGCCCGGCACTCAGTGG - Intergenic
1189669331 X:43391177-43391199 GTTCAGTGCCTAGCATTCACTGG - Intergenic
1194996556 X:100597351-100597373 GCTCTGTGCCTTGCATTCAGTGG - Intronic
1195445231 X:104945115-104945137 ATAAAGTGCCTGTCATTTAGTGG + Intronic
1197712598 X:129682562-129682584 AGTCTGTGGCTGGAATTCAGAGG - Intergenic
1198754830 X:139971543-139971565 ATTCCATGCCTGGCATACGGTGG - Intergenic
1199460445 X:148078052-148078074 ATTCTGAGGCTGGTATTCAGAGG - Intergenic
1199467480 X:148155356-148155378 GAACAATGCCTGGCATTCAGTGG + Intergenic
1199473465 X:148220554-148220576 ATGAAGTGCCTGGGAGTCAGGGG - Intergenic
1199784276 X:151090449-151090471 ATACAGTGCCTGGCACAGAGTGG + Intergenic