ID: 972694125

View in Genome Browser
Species Human (GRCh38)
Location 4:41427978-41428000
Sequence CTGAATACACAGAGGTAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 428
Summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 383}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972694125_972694127 11 Left 972694125 4:41427978-41428000 CCTTTTTACCTCTGTGTATTCAG 0: 1
1: 0
2: 2
3: 42
4: 383
Right 972694127 4:41428012-41428034 AAATTCTCTGAAATGTGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972694125 Original CRISPR CTGAATACACAGAGGTAAAA AGG (reversed) Intronic
900279341 1:1855953-1855975 CTGAGAACACAGTGGTGAAAAGG - Intronic
901361154 1:8702169-8702191 CTTAAAACACAGAGGCACAAAGG + Intronic
901707981 1:11090719-11090741 CTAATTACACAGGGGTAAACTGG + Intronic
901869728 1:12130980-12131002 GTAAAATCACAGAGGTAAAAAGG - Intronic
902698164 1:18154331-18154353 CTGAAAAAAAAGATGTAAAATGG - Intronic
903249930 1:22045496-22045518 CTGAATCCACAGAGGCACAGAGG + Intergenic
903649956 1:24916341-24916363 CTGAGCACACTGAGGTGAAAAGG + Intronic
905815286 1:40945560-40945582 CTGAAGACAAAGAAGTAAAGTGG + Intergenic
906083720 1:43111667-43111689 TTGAATACACAATAGTAAAATGG - Intergenic
906337819 1:44949404-44949426 CTGAATATACAAAGATAAAAGGG - Intronic
907023475 1:51092002-51092024 CTGAATACAAACATATAAAAAGG + Intergenic
907221637 1:52911440-52911462 CTGCATTCACATCGGTAAAATGG + Intronic
908540163 1:65114572-65114594 CTGAGAACACAGAGGTCCAATGG + Intergenic
909627761 1:77737399-77737421 CTAAATACACAGAAGTACAGAGG + Intronic
910057949 1:83054195-83054217 CTGAATTCACAGGGCTAACATGG - Intergenic
910132205 1:83921593-83921615 CTGAAGATACAGAGACAAAATGG + Intronic
910772671 1:90845593-90845615 TTAAATACACAGAGGAAAGAAGG + Intergenic
912149727 1:106843484-106843506 CATAAAACACAGAGGTAAAAGGG - Intergenic
912244070 1:107942540-107942562 CAGGATACACAGATATAAAAAGG - Intronic
913996599 1:143655909-143655931 CTGAAGACACAGTGGGAAGACGG - Intergenic
919761465 1:201100647-201100669 CTGACTAGACAGAGGGACAATGG + Intronic
919832168 1:201549518-201549540 CTAAATACACAGAGGTGAGCAGG + Intergenic
920679524 1:208061995-208062017 TTGTATACACAGTTGTAAAAAGG + Intronic
922055781 1:222041248-222041270 CTGAAGTCACAGAGGTAGAGGGG - Intergenic
922708818 1:227810710-227810732 CTGATATCACAGAAGTAAAAAGG + Intergenic
1062793952 10:328192-328214 CTGTACACACAGAGTTAAACAGG + Intronic
1063733014 10:8721025-8721047 GAGAATACACAAAGGTAAAGAGG + Intergenic
1063808106 10:9670934-9670956 CTGCATTAACAGAGGTAAACTGG + Intergenic
1063820895 10:9833977-9833999 CACTATACACACAGGTAAAAAGG - Intergenic
1063874516 10:10459149-10459171 CTGAATACTCAGATATAAAGGGG + Intergenic
1064072877 10:12245670-12245692 CTGAATAGACAGAGATCTAAAGG - Intronic
1064462761 10:15550996-15551018 ATGACTACACAGAGGTTACATGG + Intronic
1067516747 10:46954228-46954250 GTGAAGACACAGAGGAAAGACGG - Intronic
1067645504 10:48097598-48097620 GTGAAGACACAGAGGAAAGACGG + Intergenic
1067787971 10:49264682-49264704 CTGAATACACAGGTGTGATATGG - Intergenic
1068829637 10:61478732-61478754 TCTAATATACAGAGGTAAAAAGG - Intergenic
1070655791 10:78270192-78270214 CTGAATGCACAGTAGTAAAGGGG + Intergenic
1071167938 10:82828500-82828522 CTCTAAAGACAGAGGTAAAAGGG - Intronic
1072468453 10:95689821-95689843 TTGGATCCTCAGAGGTAAAAGGG + Intronic
1072944724 10:99799421-99799443 TTGCATACACAGTGGCAAAAAGG - Intronic
1073030012 10:100518592-100518614 CAGAAACCACAGAGTTAAAATGG - Intronic
1073383030 10:103095705-103095727 CTTAATAGACAGAAATAAAAGGG - Intronic
1079524758 11:21372343-21372365 CTGAATACACAGAATTAATGGGG + Intronic
1080377740 11:31733531-31733553 CTGACTCTACAGAAGTAAAAAGG + Intronic
1080714055 11:34781142-34781164 CTGAATACACATAGACATAAAGG - Intergenic
1081088788 11:38835505-38835527 CAGAATTCACACAGGTAGAAGGG + Intergenic
1082134754 11:48534316-48534338 CTGAAAACACAGAAGTAACTGGG - Intergenic
1082620317 11:55412605-55412627 CTGAAAAGACAGAAGTAAATAGG - Intergenic
1084390003 11:68869197-68869219 CGGCAGACACAGAGTTAAAAGGG + Intergenic
1086428083 11:86706532-86706554 CTCAATACACAGAGCTCTAATGG - Intergenic
1086581476 11:88404562-88404584 CTGGATAGAAAGAAGTAAAAAGG + Intergenic
1086581601 11:88406103-88406125 CTGGATAGAAAGAAGTAAAAAGG + Intergenic
1086988795 11:93279767-93279789 CTGAAAACATAGAGGCTAAAGGG - Intergenic
1087450754 11:98319868-98319890 TTGAATACAAAGAGGCAAAGGGG + Intergenic
1088779996 11:113124730-113124752 ATGAACACACACAGGAAAAATGG - Intronic
1089306666 11:117530604-117530626 CTGAAGACACAGGGGTGAATCGG + Intronic
1089812115 11:121140757-121140779 CAGAAGACACAGAGGGAAAGAGG - Intronic
1091899912 12:4136312-4136334 GTGGATACACAGAGGTGAACAGG - Intergenic
1091971618 12:4792298-4792320 CTGAAGACACAAGTGTAAAAGGG + Intronic
1093291362 12:17326788-17326810 TTGAATACTCAGAGATAAGAGGG + Intergenic
1094394336 12:29989608-29989630 TTGAATACATGGAGGTAAACAGG - Intergenic
1094734169 12:33214934-33214956 CTGAAACCACAGAAGTAGAAAGG + Intergenic
1094755065 12:33458865-33458887 CTGATTCTACAGAAGTAAAAAGG + Intergenic
1097307151 12:58081754-58081776 CTGGTGACACAGAGGTAACAAGG + Intergenic
1097562102 12:61220321-61220343 CTTACTACACAGAGGAACAAAGG + Intergenic
1098024952 12:66191474-66191496 ATGAATACACAAAGGGACAATGG - Intronic
1098579901 12:72087386-72087408 CTGAAGACACAGAAGAAAGATGG + Intronic
1098604521 12:72373837-72373859 ATGAATCCAGAGAGCTAAAAGGG + Intronic
1098992569 12:77080117-77080139 CTGAATATACAGACAAAAAAAGG - Intergenic
1099126144 12:78760771-78760793 ATAAATACACAAGGGTAAAAAGG - Intergenic
1101887204 12:108675746-108675768 CAGAATACACAAATGGAAAAAGG + Intronic
1101945429 12:109132688-109132710 GTGAATACACAGAGACAAATCGG - Intronic
1103445576 12:120993094-120993116 CTGAATACACTGAGGACATATGG + Intronic
1103942184 12:124507147-124507169 CTGAATTCATAGAGACAAAAAGG + Intronic
1105430498 13:20332995-20333017 CTGAACACACAGAGGTCAGGGGG + Intergenic
1105669887 13:22601295-22601317 ATGAATACATGTAGGTAAAATGG - Intergenic
1106202840 13:27556227-27556249 CAGAATAAAGAGAGGTAAGATGG - Exonic
1106397985 13:29399863-29399885 ATGAATACTCGGAGTTAAAAAGG + Intronic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1107033923 13:35881024-35881046 CTGAATATACAGATGAACAATGG + Intronic
1107153538 13:37140211-37140233 CAGAAAACACAGAAGTGAAAGGG - Intergenic
1107309957 13:39066122-39066144 ATGAATACACAGTGGGGAAAAGG - Intergenic
1109286473 13:60414928-60414950 CTGCTTAAACAGAGGGAAAAGGG + Intronic
1109636418 13:65123714-65123736 CAGAATACACACAGGGAAGAAGG + Intergenic
1110076011 13:71244123-71244145 CTGAAAACACAAAAGTAATACGG - Intergenic
1110318860 13:74137185-74137207 CTGCAAACACAGAGGTAGAGAGG - Intergenic
1111043083 13:82777007-82777029 ATGATTACACAGAAGGAAAATGG - Intergenic
1111637043 13:90919222-90919244 CTGATTATACAGAGGTCAAACGG - Intergenic
1111801009 13:92980840-92980862 CAGAAGACAGAGAGGAAAAAAGG - Intergenic
1111940990 13:94606593-94606615 CTGAATAATAAGAGGAAAAAGGG - Intronic
1112423530 13:99275695-99275717 CAGAAAACAAAGAGGTAAAAAGG - Intronic
1112666950 13:101585856-101585878 GTGAATACCCATAGGAAAAAGGG - Intronic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1115012163 14:28562053-28562075 CTGAAGACAGTGAGGAAAAAGGG + Intergenic
1115335497 14:32240990-32241012 ATGCACACAAAGAGGTAAAATGG - Intergenic
1115379490 14:32719180-32719202 GTGAATACATAAAGGTATAATGG + Intronic
1116146083 14:41070788-41070810 CTGAATATACAGATAGAAAATGG - Intergenic
1116603215 14:46954844-46954866 GTGAATACAGAGAGGGTAAAAGG - Intronic
1116981200 14:51172585-51172607 GTGAATTCACAGAGATAGAAAGG - Intergenic
1117426570 14:55604656-55604678 CTGAGTAAACAGCAGTAAAAGGG - Intronic
1118505155 14:66403103-66403125 CTGTTTCCTCAGAGGTAAAATGG + Intergenic
1118512111 14:66486825-66486847 CTGGATTCCTAGAGGTAAAAAGG + Intergenic
1119251979 14:73164126-73164148 CTGACTAGACAGAGGTACTAAGG + Intronic
1119816092 14:77569230-77569252 ATGAAGACACAGAGGTTAAAAGG - Intronic
1120470690 14:84919756-84919778 CTGAATCAACAGATGTGAAATGG + Intergenic
1121596616 14:95168208-95168230 CAGAATAAACAGAGGGAGAAGGG - Intergenic
1124440450 15:29681998-29682020 GTGAACACACAGAGGCAAAGCGG + Intergenic
1126351111 15:47745596-47745618 CTGGGTCCACAGAGGCAAAATGG - Intronic
1126399338 15:48253321-48253343 TTGACTACACAGGGGTATAATGG - Intronic
1127001841 15:54517928-54517950 TTGTATAAATAGAGGTAAAAAGG + Intronic
1128297837 15:66539977-66539999 CTGAGGACAAAGAGGTAAACGGG - Intronic
1128869777 15:71145619-71145641 CTGAATACAGAAAGGAAGAAAGG + Intronic
1129690262 15:77709352-77709374 CTGCATACAGTGAGGTCAAATGG - Intronic
1130538751 15:84805690-84805712 CTGAATATACAGTGGTGAACAGG - Exonic
1131321922 15:91402061-91402083 GGGAATACACAGAGGTCACAGGG + Intergenic
1133455209 16:5935877-5935899 CTGAATTCACAGAGGTATAATGG + Intergenic
1133831685 16:9329317-9329339 TTGAATTCACAGAGGTGATAAGG - Intergenic
1134072299 16:11268157-11268179 CTGGATTCACATAGGTCAAAAGG - Intronic
1135572888 16:23562899-23562921 CTGAAAACAATGAGGGAAAACGG - Intronic
1135856687 16:26018152-26018174 CTGGCCACACAGAGATAAAAAGG - Intronic
1137913835 16:52406673-52406695 CTAACTATACAGAGGAAAAATGG + Intergenic
1137964715 16:52919122-52919144 CTGGATACAGAGTGGTGAAATGG + Intergenic
1139146651 16:64332707-64332729 CTGAAGACACAGAAATGAAAAGG + Intergenic
1139724806 16:68888580-68888602 CTGGAAACAGAGAGATAAAATGG - Intronic
1140145427 16:72302358-72302380 CTGCCTACACAAAGCTAAAACGG - Intergenic
1140274023 16:73492591-73492613 TTGAAACCACAGATGTAAAATGG + Intergenic
1140587491 16:76310129-76310151 CTGAATACACAAATGGCAAATGG - Intronic
1141121162 16:81358107-81358129 CTGAAGATACAGAGATAATAAGG - Intronic
1142221706 16:88858082-88858104 CTGAACACACACAGGGTAAATGG + Intronic
1142889943 17:2936719-2936741 ATAAAGCCACAGAGGTAAAAAGG - Intronic
1145355529 17:22144280-22144302 TTGATTAGACAGAAGTAAAATGG - Intergenic
1147268776 17:39251876-39251898 CAGAATAAACAGATGTAAAGTGG + Intergenic
1147298419 17:39503742-39503764 CTGAGTAGACAGAGCTAAATGGG - Intronic
1148026740 17:44593915-44593937 CTGCAAACTCAGAGGCAAAAAGG - Intergenic
1149417180 17:56471368-56471390 CTGAATACCTAGAGGTGATAAGG - Intronic
1150336387 17:64333597-64333619 CTGGATACTTAGAGTTAAAATGG + Intronic
1152435040 17:80271350-80271372 CTGAGTACTCAAAGGGAAAAAGG + Intronic
1152473806 17:80504454-80504476 ATGGATGCACAGAGGGAAAAAGG + Intergenic
1155736184 18:29225148-29225170 CTGGATACACAAGGGAAAAAAGG - Intergenic
1156104201 18:33637323-33637345 CAGAAAACACAGAGTTAAACAGG + Intronic
1158487272 18:57878687-57878709 ATGAAGACACAGAGGAACAATGG + Intergenic
1159397434 18:67880237-67880259 CTGAAACCACAGAGCTACAAAGG - Intergenic
1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG + Intergenic
1159655035 18:71023165-71023187 CTGAAAACACAGACCTACAAAGG - Intergenic
1160154525 18:76423574-76423596 CGAAACACACACAGGTAAAAAGG + Intronic
1160154603 18:76423980-76424002 CGAAACACACACAGGTAAAAAGG + Intronic
1160154668 18:76424323-76424345 CGAAACACACACAGGTAAAAAGG + Intronic
1160553495 18:79711382-79711404 CTGGATACTCAGAGGCAAAAGGG - Intronic
1161540293 19:4846752-4846774 GTGAATACACAGAGAGAAGATGG + Intronic
1164781063 19:30893253-30893275 CTGAAAACACAGATGGAGAATGG + Intergenic
1165647121 19:37450467-37450489 CTGATGCCACAGAAGTAAAAAGG - Intronic
1165679320 19:37760485-37760507 TTGAATAAATAGAGGAAAAAGGG + Intronic
1165799048 19:38536474-38536496 ATGAAGACATAGAGGTAGAAAGG - Intronic
1166395032 19:42433407-42433429 CTGAAAGCAGAGAGGCAAAATGG - Intronic
1168184591 19:54691311-54691333 ATATATACACAGAAGTAAAATGG - Intronic
1168363462 19:55763246-55763268 CTAGATACACATAGGTACAAAGG + Intergenic
1168364419 19:55773250-55773272 CTAGATACACATAGGTACAAAGG + Intergenic
926269352 2:11353539-11353561 CTGAGGCCACAGAGGTAAAAAGG - Intergenic
927067214 2:19485285-19485307 CTGAAAAACCAGAGGTACAATGG + Intergenic
927209761 2:20631861-20631883 CTGAATACACAAAGGGACAATGG + Intronic
927469338 2:23360849-23360871 CTGAATCCAAAGAGGTGACAAGG + Intergenic
929011747 2:37451854-37451876 CTGAATATACAAAGGGACAATGG - Intergenic
930273614 2:49285158-49285180 CAGAATACATAAAGGAAAAATGG + Intergenic
930303060 2:49641456-49641478 CTGAAGATATAGAAGTAAAATGG - Intergenic
930346886 2:50194129-50194151 CTGATTACATAATGGTAAAATGG + Intronic
931748503 2:65310974-65310996 TTTTTTACACAGAGGTAAAAAGG + Exonic
933353042 2:81179671-81179693 TTGAATACAAACAAGTAAAAAGG + Intergenic
935730588 2:106062109-106062131 CTGAATGCACACAGGGGAAAGGG - Intergenic
936375748 2:111939971-111939993 CTGATTAGACAGAGGCAGAAGGG - Intronic
936665841 2:114594414-114594436 GTGAATACATATATGTAAAAGGG + Intronic
937804161 2:126118036-126118058 ATGAATTCACAGAGGTGGAAAGG + Intergenic
937804777 2:126126570-126126592 CTGAATACACACAGGAAAAAAGG - Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
937862976 2:126726586-126726608 CTCAATATAAAGAGATAAAAAGG + Intergenic
938227920 2:129633546-129633568 CTGAACAAATAAAGGTAAAATGG - Intergenic
938575765 2:132602697-132602719 CTGAATAATCTGATGTAAAATGG + Intronic
939121457 2:138122743-138122765 GTAAATACAGAGAGGTAAAGAGG + Intergenic
939722533 2:145672266-145672288 CTGAAGAAACAGAGGCAAAAAGG - Intergenic
940334848 2:152515247-152515269 ATGAATACACAAATATAAAACGG - Intronic
940506641 2:154563363-154563385 CAGAAAAAACAGATGTAAAAGGG - Intergenic
940665119 2:156599684-156599706 GTGAAGAAACGGAGGTAAAAAGG + Intronic
941115694 2:161469744-161469766 CTGAATAGAAGGAGGGAAAATGG + Intronic
941589194 2:167397717-167397739 CTGAGAACACAGAGGTATACAGG - Intergenic
941755741 2:169183925-169183947 CTGAAAACACAAAGGCAGAATGG - Intronic
941981612 2:171464451-171464473 TTGAAGACACAGAGGGAGAAAGG - Intronic
943105235 2:183538259-183538281 CTGAATAGAAATGGGTAAAAAGG - Intergenic
943349045 2:186775732-186775754 CTAAAGACACAGAAATAAAAAGG + Intergenic
943497535 2:188641607-188641629 CAGAATACATAGAAATAAAATGG + Intergenic
943922978 2:193733739-193733761 TTGAATAGACAGATGTAACAAGG + Intergenic
944073418 2:195699112-195699134 CTGATTACAAAGAAATAAAAAGG - Intronic
944383123 2:199134804-199134826 ATGAATTCACAGATGCAAAATGG + Intergenic
945052158 2:205834391-205834413 CCGAAAACACAGAGGGAAAAGGG - Intergenic
945567281 2:211416451-211416473 CTGAATATACAAAGGGACAATGG + Intronic
946622568 2:221574343-221574365 CTGATTGCACACAAGTAAAAAGG + Intergenic
1169239291 20:3961486-3961508 AGGAATACAATGAGGTAAAAGGG + Intronic
1170521811 20:17193920-17193942 CTGATTACAGAGGGGTACAAGGG - Intergenic
1172053837 20:32140419-32140441 CTGAAGACACAGAGATAAATAGG + Intronic
1173566613 20:44043366-44043388 CTGAGAACAGAGAGGTACAAAGG - Intronic
1173718125 20:45229457-45229479 CTGGATACACAGTGGGAAGAGGG + Intergenic
1174384378 20:50178418-50178440 GTGAACACACAGAGGGAAGAAGG + Intergenic
1174612296 20:51808124-51808146 ATGAATAAACAGAGGTCCAAAGG - Intergenic
1174730174 20:52908387-52908409 ATGAGAACACAGAGGTAATAAGG + Intergenic
1174881331 20:54282450-54282472 CAGAGTAAACAGAGGTAAAGAGG - Intergenic
1175534849 20:59702374-59702396 CTGAATAAAAAGAAGAAAAAAGG - Intronic
1176957605 21:15124190-15124212 CTGGGTAAACAGAGGTAAGACGG + Intergenic
1177318059 21:19486782-19486804 CTAAATACAAATAGGTAAAACGG - Intergenic
1177650889 21:23961010-23961032 CTGAATATACAAAGGGACAATGG - Intergenic
1178092765 21:29181906-29181928 CTGAAGACAGAGAGATAAAAGGG + Intergenic
1178548788 21:33517266-33517288 CTGATTACTTAGAGCTAAAAGGG - Intronic
1179113526 21:38468338-38468360 CTGAATATAGAGAGGGAAATTGG + Intronic
1180100943 21:45585173-45585195 ATGACCACCCAGAGGTAAAAGGG - Intergenic
1181104430 22:20565377-20565399 CCCAAGACACAGAGGTAAACAGG - Intronic
1182114557 22:27748199-27748221 CTGAAGAGACTGATGTAAAAAGG + Intergenic
1182531059 22:30957838-30957860 TTGTATACACAGAGGTAAAGAGG + Intronic
1182594192 22:31405521-31405543 ATGAATAAACTGAGGGAAAAAGG - Intronic
1184489965 22:44802797-44802819 GGGAAGACACAGAGGCAAAAAGG - Intronic
1184675924 22:46043554-46043576 CTGAAGACATAGAGGTAATGGGG - Intergenic
949306114 3:2643103-2643125 ATTAATACATAGAGATAAAAGGG - Intronic
949791923 3:7802052-7802074 CTGAATGCTCAAAAGTAAAAGGG + Intergenic
950894020 3:16431753-16431775 CTGACTACTGAGGGGTAAAATGG + Intronic
951127603 3:19002127-19002149 CTGAAGGCACAGAAGCAAAAAGG - Intergenic
951565229 3:24006318-24006340 CAGAATACATTTAGGTAAAATGG - Intergenic
952407867 3:33020892-33020914 CTACATACACAGAGAGAAAAAGG + Intronic
952954662 3:38549575-38549597 GTGAAAACACAGGGGGAAAATGG + Exonic
953188760 3:40663810-40663832 CTGATTAGACAAAGTTAAAAGGG + Intergenic
953488271 3:43323936-43323958 ATGACTACACAGAGGCACAAAGG + Intronic
954966234 3:54613593-54613615 CTTAAGACTCAGAGGTAAGATGG - Intronic
956281116 3:67558070-67558092 CGGAATAAACAGAGGTCAAAGGG - Intronic
957701409 3:83719732-83719754 ATCAATACAGAAAGGTAAAAAGG + Intergenic
959324112 3:104914188-104914210 CTGAATAAGCAGAGGCAAGAAGG + Intergenic
960511819 3:118558370-118558392 CTGAATAGAAATAGATAAAATGG + Intergenic
962993676 3:140603852-140603874 ATGAATACACAGAAGTAGAATGG + Intergenic
963204610 3:142619865-142619887 CAGATTACTCAGAGGTATAATGG + Intronic
963909609 3:150804941-150804963 CTGAACTCACAGAGGTGAGAGGG + Intergenic
964215165 3:154272127-154272149 TTGACTACAAAGGGGTAAAAGGG + Intergenic
964523737 3:157594998-157595020 GTGAAAACACAGAGAGAAAATGG + Intronic
964965289 3:162484420-162484442 CTGATCACACAGAAATAAAATGG - Intergenic
965248804 3:166314095-166314117 CTTTATAAACAGAGATAAAATGG + Intergenic
965370173 3:167852334-167852356 CTGAGTACACAAAGGGAAATAGG + Intergenic
965833319 3:172823107-172823129 ATGAATAGAAAGATGTAAAAAGG + Intergenic
965988436 3:174785887-174785909 CTGAAAACACAGTGGTAAAGAGG - Intronic
967769194 3:193315086-193315108 CTGAATACAAAGAGAAAAAGTGG - Exonic
968792978 4:2681154-2681176 TTGATTACACAGAAATAAAAGGG - Intronic
970831432 4:20344761-20344783 CTTAACCCACAGAGGTTAAAGGG - Intronic
971059265 4:22949092-22949114 CTGAGTATAAGGAGGTAAAAAGG - Intergenic
971528283 4:27651018-27651040 GTGATTAAACAGAGATAAAATGG + Intergenic
972016356 4:34250883-34250905 ATGAATACTAAGAGGCAAAATGG - Intergenic
972694125 4:41427978-41428000 CTGAATACACAGAGGTAAAAAGG - Intronic
972904808 4:43731901-43731923 ATGGATACACAAAAGTAAAAAGG + Intergenic
972956768 4:44402079-44402101 CTGAATTCACAAAGGTAAAGTGG + Intronic
973308628 4:48682052-48682074 ATGAAAACACAAAGGTAACAGGG + Intronic
974466059 4:62258087-62258109 CTGGAGACACAGAGAGAAAATGG - Intergenic
974496580 4:62636132-62636154 TTGAGTACACAGAGATATAAAGG + Intergenic
975261571 4:72307308-72307330 CTGAGTACACAGTGGCTAAAAGG + Intronic
975599258 4:76082297-76082319 CTGAATATGCCAAGGTAAAATGG - Exonic
975897327 4:79108263-79108285 ATGAATAGAAAGAGGTGAAATGG - Intergenic
976404367 4:84645633-84645655 ATGAATACTAAGAGTTAAAAAGG + Intronic
976752368 4:88462470-88462492 CTGAAGACAGAGAGGTAATCAGG - Intronic
977079702 4:92509461-92509483 CTAAATGCACTGAGGCAAAAAGG + Intronic
977402649 4:96553330-96553352 CTGAATACATGGAGTTAAAATGG + Intergenic
979096588 4:116558623-116558645 CTGAATACCCACAGGAGAAAGGG - Intergenic
979990467 4:127368975-127368997 CTGAATACACAGAAGAAAACAGG + Intergenic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
981350211 4:143720841-143720863 CTGAATCATCAGAGGCAAAATGG + Intergenic
981520939 4:145661712-145661734 GTCAATACACAGAGGAGAAAAGG - Intergenic
981997622 4:150991672-150991694 ATGACTACAAAGGGGTAAAAGGG + Intronic
982470181 4:155779706-155779728 CTGATTACACAGAAATTAAATGG + Intronic
983098352 4:163593348-163593370 CTGCATACATTGAAGTAAAAAGG + Intronic
983290466 4:165797756-165797778 GTGAGTACACAGAGGGGAAAGGG + Intergenic
983593316 4:169439192-169439214 CTGCATACACAGGGTTAAAATGG + Intronic
983970329 4:173863819-173863841 CAGAATCCACAGAGGTGAGATGG - Intergenic
984546372 4:181109042-181109064 CCAAATACACATAGGGAAAAGGG + Intergenic
986076551 5:4343885-4343907 ATGAACACACAGAGGGAAGAAGG + Intergenic
986383418 5:7208431-7208453 CTGAACCCACAGGGGTGAAATGG - Intergenic
987904488 5:24058369-24058391 CTGAATACACAGTTGAGAAAAGG + Intronic
987949032 5:24652379-24652401 CTGAAAAAACAGATGGAAAAGGG + Intergenic
988373655 5:30405308-30405330 TTGAAAACAAAGAGGTAAATGGG + Intergenic
989228493 5:39058973-39058995 CTGAAGACACAGAAGAGAAATGG + Intronic
989518617 5:42374510-42374532 CTGAAGACACAGAAATCAAATGG + Intergenic
991491767 5:67190767-67190789 ATGAATACCTAGAGGGAAAAGGG - Intronic
991502460 5:67290419-67290441 CTGAATAGAGAAAGGGAAAAGGG + Intergenic
991628545 5:68630501-68630523 ATGAATAAACAAAGGAAAAATGG + Intergenic
992391888 5:76337239-76337261 CTGAAGACACAGAGAGAAGATGG - Intronic
992430691 5:76708554-76708576 GTGAATACAGAGAGGTAGAGAGG + Intergenic
992536068 5:77704992-77705014 CTACATACACAGATGTAAAAGGG - Intronic
993210319 5:84941198-84941220 GTGAATACATATAGATAAAAAGG + Intergenic
993408545 5:87544921-87544943 GTGAATTCAGAGAGGTAATAGGG - Intergenic
993531367 5:89028768-89028790 CTGATTACACAGAAGCAGAAGGG - Intergenic
994261498 5:97664655-97664677 CTAATTACATATAGGTAAAAAGG - Intergenic
994676927 5:102834826-102834848 CTCAATACACAGCAGTCAAAAGG - Intronic
994679916 5:102873485-102873507 CTGACCACACAGAGGTGATAAGG - Intronic
995751316 5:115455991-115456013 CTGAATACACAGAGAGGAAAGGG - Intergenic
995865819 5:116689390-116689412 TTGAATACACAGAAAAAAAAAGG - Intergenic
996662714 5:126023004-126023026 CTGAATATACAAATGAAAAATGG - Intergenic
997684638 5:135780077-135780099 CTTAATATACAGGGGAAAAAAGG + Intergenic
997804713 5:136905720-136905742 CTGAATACACAGAGGCAGACAGG - Intergenic
999170740 5:149592481-149592503 CTGAATACTCAGAAATGAAAAGG - Intronic
1000769999 5:165341043-165341065 ATGACTACAGAGAAGTAAAAGGG + Intergenic
1000793184 5:165632030-165632052 CTGAAGACCCAGAGGTTAAGTGG + Intergenic
1000842016 5:166231738-166231760 CTGAATAGAAAGGGATAAAAAGG - Intergenic
1001012122 5:168107978-168108000 CTAAATACAGGGAGGTACAAAGG - Intronic
1001345645 5:170895820-170895842 TTGGATACACAGAGCTAAATGGG - Intronic
1002758886 6:186562-186584 CTGAAAACACAGAAGTACAAAGG + Intergenic
1002857783 6:1053304-1053326 CTGAGTACACATGGGTGAAAAGG - Intergenic
1002870076 6:1158782-1158804 CTAAATACACAGTTGTAAAAGGG + Intergenic
1003246389 6:4385691-4385713 CTGATTCCCCTGAGGTAAAAGGG - Intergenic
1003435638 6:6085455-6085477 AGGAATACAGAGTGGTAAAATGG + Intergenic
1003725924 6:8763810-8763832 CTGAATTCACAGAGTTAATAAGG + Intergenic
1003800393 6:9658513-9658535 CTGAATACACAGAGATGAAGAGG + Intronic
1004546639 6:16604183-16604205 CTCAATACAAAGAGATAAAGAGG + Intronic
1006389136 6:33748328-33748350 CTCATTTCACAGAGGTAAGATGG + Intergenic
1008448815 6:51625267-51625289 TTAAAAACACAGAGGGAAAAGGG + Intronic
1009478995 6:64131656-64131678 CTGAATATGCAGATGAAAAATGG + Intronic
1010632282 6:78212444-78212466 AAGAATACACAATGGTAAAAGGG - Intergenic
1012101864 6:95099846-95099868 CTGATTACACAAAAATAAAATGG - Intergenic
1014312191 6:119817593-119817615 TTGAGTATACAGAGATAAAAAGG + Intergenic
1014334369 6:120114303-120114325 GTGAATACTCAGAAGTAACATGG + Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017347292 6:153398820-153398842 CTGAAGACACTGGGCTAAAATGG - Intergenic
1017631474 6:156400248-156400270 TTCAATACACAGAGGAGAAAGGG + Intergenic
1018579078 6:165292147-165292169 CTGAGTTCAAAGAGGCAAAAAGG + Intronic
1018946027 6:168347070-168347092 CTGACTCAACAGAGATAAAAAGG - Intergenic
1019391217 7:787661-787683 CAGAAGCCACAGAGGTCAAAGGG - Intergenic
1020501478 7:8927383-8927405 CTGAAGACACAGTGGTGAACAGG - Intergenic
1020600190 7:10265516-10265538 TTGAACACACAAAGGTAAGAGGG - Intergenic
1021529503 7:21628328-21628350 TTGAATACAAAGAGTGAAAATGG + Intronic
1021581845 7:22163082-22163104 GTGTGAACACAGAGGTAAAAGGG + Intronic
1022138969 7:27475721-27475743 CTGGGTACAAAGAGGTAAACTGG + Intergenic
1023504696 7:40887579-40887601 CAGAATACACAGGGGTGAGAAGG + Intergenic
1023547183 7:41330488-41330510 CTGATTACACAGAAACAAAAAGG + Intergenic
1023776424 7:43612045-43612067 CTGAATATACTGAGGAGAAAGGG - Intronic
1024410147 7:49031059-49031081 CAGAAGCCACAAAGGTAAAACGG + Intergenic
1024775052 7:52774284-52774306 CTTAAAAAACAGAGGGAAAAAGG + Intergenic
1027415544 7:77970137-77970159 CTAAATACTTAGCGGTAAAATGG + Intergenic
1027597325 7:80190039-80190061 CTGAATATACAGAATTATAAAGG - Intronic
1028294739 7:89114645-89114667 TTGATTACACAGATGTGAAAAGG + Intronic
1028660862 7:93272858-93272880 CTGAATTAACAGTGATAAAATGG + Intronic
1028770640 7:94616599-94616621 CATAATATACACAGGTAAAAAGG + Intronic
1029132865 7:98346775-98346797 CTGAAGACACAGAAATGAAATGG + Intronic
1029801493 7:102952504-102952526 CTGACTTTACAGAAGTAAAAAGG + Intronic
1030389467 7:108908192-108908214 CTGAAAACACAGTAGAAAAATGG - Intergenic
1031491057 7:122388963-122388985 TTTCATACAAAGAGGTAAAATGG + Intronic
1031697448 7:124875754-124875776 CTGAAAACAGAGAGGAAATATGG + Intronic
1031788118 7:126060448-126060470 CCGAATACACAAACATAAAAGGG - Intergenic
1031790785 7:126100927-126100949 TTGAATTCACTGAGATAAAATGG + Intergenic
1032112554 7:129088417-129088439 GTGAATACACAGAGGTGGAAAGG + Intergenic
1032203232 7:129838588-129838610 AAACATACACAGAGGTAAAATGG + Intronic
1032997917 7:137468923-137468945 ATGAATATACAGAGGTGAGAAGG + Intronic
1033363455 7:140654143-140654165 CTGAATACGCAAAGGGACAATGG - Intronic
1034672263 7:152867682-152867704 CTGAATACACAAATGGACAATGG - Intergenic
1034892170 7:154850763-154850785 CTGATAACACAGAAGTACAAAGG - Intronic
1035251336 7:157599433-157599455 CTGAATACACAGTGTAAAGATGG + Intronic
1036575912 8:10027551-10027573 CTGAAGACCCAGAGGTACAAGGG + Intergenic
1036726860 8:11228408-11228430 CTTATTTCACAGAGGAAAAAAGG - Intergenic
1037035421 8:14160714-14160736 GTGAGGACACAGAAGTAAAATGG - Intronic
1037305552 8:17499419-17499441 CTGAACACACAGAGAGAGAAGGG - Intronic
1037552818 8:19991710-19991732 CAGAATACACCGAGGTCAGAAGG - Intergenic
1038378703 8:27070936-27070958 CTGAGGCTACAGAGGTAAAATGG + Intergenic
1038602932 8:28966079-28966101 TTGAAATCACAGAGGTAAAAAGG - Intronic
1039092400 8:33846175-33846197 CTGAAGCCACAGAGAAAAAAGGG + Intergenic
1039575453 8:38620176-38620198 CTGAATGGGCAGAGGGAAAAAGG - Intergenic
1040810168 8:51443368-51443390 CTGAAAACAAAGAGCTAAAAGGG + Intronic
1040967277 8:53096158-53096180 CCGATGACACAGAAGTAAAAAGG + Intergenic
1041009098 8:53523985-53524007 CAGCAGACACAGAGTTAAAAGGG - Intergenic
1042086147 8:65111576-65111598 CTGACTGCCCAGAGGTAAACAGG + Intergenic
1042209462 8:66365130-66365152 CTGAATACAGAGAGGAACAAAGG - Intergenic
1042414351 8:68501866-68501888 CTAGATACACATAGGTACAAAGG + Intronic
1042568163 8:70133559-70133581 CTGAATACTAAAAGGGAAAATGG + Intronic
1042896231 8:73671448-73671470 CTGAGAACACTGAGTTAAAAAGG - Intronic
1043780772 8:84332440-84332462 CTGAAAAGACAGAGGACAAAGGG + Intronic
1043994189 8:86792338-86792360 TTGAAGACTCAGAGGTGAAACGG + Intergenic
1044051650 8:87513482-87513504 CTGAATACATAGATGTTTAAGGG + Intronic
1044758121 8:95488413-95488435 CTTAATACACAGTGTGAAAATGG + Intergenic
1044821636 8:96159542-96159564 CTTAATACACAAAGGTACATGGG - Intronic
1047598721 8:126405417-126405439 CAGATTTCACAGACGTAAAAAGG + Intergenic
1047683924 8:127284176-127284198 GTGCATAAACAGAGATAAAATGG + Intergenic
1047869072 8:129062305-129062327 CAGAATACACTGAACTAAAAGGG + Intergenic
1048413384 8:134199074-134199096 CTGAACACAGAAAGCTAAAAGGG + Intergenic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1050010009 9:1175941-1175963 CTGATTCCAAAGAGGTACAAGGG - Intergenic
1050944128 9:11496808-11496830 CTGAATCATCAGAGGTATAAGGG - Intergenic
1051055915 9:12985558-12985580 CTGAATACAGAGGGGAAAATTGG - Intergenic
1051861961 9:21635782-21635804 CAGAATACACAGGATTAAAAAGG - Intergenic
1052081979 9:24217543-24217565 CTGAAAACACATGGATAAAATGG - Intergenic
1052477392 9:28977661-28977683 CTGTATACATACATGTAAAATGG + Intergenic
1052636176 9:31107611-31107633 ATAAATACACATATGTAAAATGG - Intergenic
1053209770 9:36218028-36218050 CTAATTACTCAGAGGTAAAAAGG - Intronic
1053362237 9:37496847-37496869 CTGGACTCACAGAGATAAAAAGG - Intronic
1053399395 9:37804473-37804495 CTTAAAAGACAGAGGAAAAAGGG + Intronic
1053564956 9:39239697-39239719 CTGAATTCACAGAAGTACAGAGG + Intronic
1054132194 9:61379342-61379364 CTGAATTCACAGAAGTACAGAGG - Intergenic
1055547794 9:77398653-77398675 CTGAATCCACAGAAGTTAATGGG - Intronic
1057033126 9:91793847-91793869 CTAATTAAACAGAGGTAAACTGG + Intronic
1057224288 9:93280489-93280511 TTAAGTACACAGAAGTAAAATGG - Intronic
1058276682 9:103050305-103050327 CAGATTACACAGAAGTTAAATGG + Intergenic
1058476128 9:105335040-105335062 CTGAATATACAAAGTTAAATGGG - Intronic
1058847878 9:108979932-108979954 CTGAATTAACAAAGGAAAAATGG - Intronic
1059135738 9:111804310-111804332 CAGAATACAAACAGATAAAAAGG + Intergenic
1059858236 9:118425913-118425935 CTTCATACACAGAGGAAATACGG - Intergenic
1060522149 9:124300057-124300079 CTGAGGACACAGAGGGAGAAGGG + Intronic
1187296206 X:18003308-18003330 AAGAATACACAGACGGAAAATGG - Intergenic
1187489770 X:19739989-19740011 CAGAAGACACAGAGATAGAAAGG + Intronic
1187598934 X:20805439-20805461 CAGAAAACACAGAGATAAAAGGG + Intergenic
1188285785 X:28324181-28324203 CTATATACACAGAGGTAACTAGG + Intergenic
1188837959 X:34981775-34981797 CTGAATAGAATGAGGTAAAAGGG - Intergenic
1189162418 X:38823361-38823383 CTGAAGATAAAGATGTAAAAGGG + Intergenic
1189386818 X:40543868-40543890 TGGAATCCACAGAGGTGAAACGG + Intergenic
1189985409 X:46549172-46549194 CTTGAGACACAGAGGGAAAAAGG - Intergenic
1191021702 X:55867414-55867436 GTGGATACCCAGAGGTAAATTGG + Intergenic
1191055119 X:56232914-56232936 CTGAATTGGTAGAGGTAAAAGGG + Intronic
1193431735 X:81414880-81414902 CTGAAGACACACTGGCAAAAGGG + Intergenic
1194460731 X:94164581-94164603 ATGAATACACAATGGTGAAAAGG - Intergenic
1195286611 X:103391447-103391469 CTGAAGCCACAGAAATAAAAAGG + Intergenic
1196036692 X:111152899-111152921 TGGAATACTCAGAGATAAAAAGG - Intronic
1197043310 X:121966655-121966677 CTGAAGAGACAGAGGTAGAAAGG + Intergenic
1197272843 X:124444711-124444733 CTGAGTACTCAGAGGTAGAATGG - Intronic
1197274913 X:124467049-124467071 CTGAGTAAATACAGGTAAAATGG + Intronic
1197636091 X:128916398-128916420 TTGAATAGACATAGGTAAGAGGG + Intergenic
1198469747 X:136935098-136935120 CAGCAGACACAGAGTTAAAAAGG - Intergenic
1198864344 X:141105396-141105418 CTCACTGCACAGAAGTAAAATGG + Intergenic
1198898345 X:141482020-141482042 CTCACTGCACAGAAGTAAAATGG - Intergenic
1199202486 X:145108583-145108605 CGGTATACACAGTGGTTAAAAGG + Intergenic
1199585148 X:149406891-149406913 ATGAAGACAAAGTGGTAAAATGG + Intergenic
1199782807 X:151078553-151078575 CTGTTTACTCAGAAGTAAAATGG - Intergenic
1200679746 Y:6195920-6195942 CTGAATAATCAGAGACAAAAAGG - Intergenic
1200849637 Y:7869726-7869748 ATGAATACACAGAGAGAAAAAGG + Intergenic
1201857105 Y:18556834-18556856 CTGGAAACATGGAGGTAAAATGG - Intronic
1201876216 Y:18763546-18763568 CTGGAAACATGGAGGTAAAATGG + Intronic