ID: 972696554

View in Genome Browser
Species Human (GRCh38)
Location 4:41452071-41452093
Sequence GAGGCTCTACAGACTAGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 81}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972696554_972696562 22 Left 972696554 4:41452071-41452093 CCAGCTCTAGTCTGTAGAGCCTC 0: 1
1: 0
2: 0
3: 3
4: 81
Right 972696562 4:41452116-41452138 TATTGAAAGAACTGACAAAAAGG 0: 1
1: 0
2: 2
3: 34
4: 426

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972696554 Original CRISPR GAGGCTCTACAGACTAGAGC TGG (reversed) Intronic
901756375 1:11443936-11443958 AAAGATCTACAGACTTGAGCGGG - Intergenic
902090363 1:13898170-13898192 TAGGCAGTACAGACTCGAGCTGG + Intergenic
902873523 1:19327865-19327887 TAGGCTGTGCAGACGAGAGCTGG + Intronic
902960665 1:19960948-19960970 GAGGCTCCAAAGCCTAGAGCAGG - Intergenic
906645328 1:47470506-47470528 GAGCCTCTCTAGACTAGAGATGG + Intergenic
908512155 1:64858060-64858082 GAGGCTCTTCTGTCTTGAGCTGG - Intronic
908789374 1:67766687-67766709 GAGGCCCTACAGAGGAGACCGGG - Intronic
915621996 1:157091772-157091794 GAGGAACTTCAGACTACAGCAGG - Intergenic
1067253325 10:44608681-44608703 GAAGATGTACAGGCTAGAGCTGG + Intergenic
1076068757 10:127469365-127469387 GAGGCTGGGCAGACAAGAGCTGG + Intergenic
1078657619 11:13256370-13256392 GAGGATCTACATACTAGAGTAGG + Intergenic
1080280325 11:30549720-30549742 GAACCTCCAGAGACTAGAGCTGG - Intronic
1081692278 11:45086611-45086633 GAGACAGCACAGACTAGAGCAGG - Intergenic
1082222352 11:49655181-49655203 GAGACTCTACAGATCAGTGCAGG - Intergenic
1082762495 11:57141391-57141413 AAGGCTCTGCAGACCAGAGTGGG + Intergenic
1086626690 11:88964019-88964041 GAGACTCTACAGATCAGTGCAGG + Intronic
1089792868 11:120957021-120957043 GGGGCTCTAGAAGCTAGAGCCGG - Intronic
1094752158 12:33423236-33423258 GAGTCCCAACAGACTGGAGCTGG + Intronic
1096081588 12:48836834-48836856 GAGGCTCTACAGAAAGGAGTTGG - Intronic
1098092054 12:66914069-66914091 AATGCTCTACAGACTACAGAAGG + Intergenic
1099493399 12:83314083-83314105 GGGGCTCTACAGACATCAGCTGG + Intergenic
1105917456 13:24929870-24929892 GACGCTCAACAGATTTGAGCAGG - Intergenic
1107279885 13:38721540-38721562 GAGCCTGTATAGACCAGAGCTGG + Intronic
1110318111 13:74134035-74134057 GAGGCTCCCCACACTAGACCGGG - Intergenic
1113732554 13:112652298-112652320 GATGCTCTGCAGACTAGACACGG - Intronic
1117747504 14:58885660-58885682 AAGGCCCTCCAGTCTAGAGCAGG - Intergenic
1126414825 15:48406618-48406640 AAGGCTCAACAGACTAGATTGGG - Intergenic
1126870185 15:52979001-52979023 TGGGCTCTACTGATTAGAGCTGG + Intergenic
1128558767 15:68650833-68650855 GAGGCCCTACAGGCCAGAGAGGG + Intronic
1129701350 15:77770222-77770244 GGGGCTCTACTGACTGGATCTGG + Intronic
1131116786 15:89800918-89800940 GAGGAACTAGAGACCAGAGCGGG + Intronic
1133425430 16:5684453-5684475 GTGGCTCTACAGAGGAGAGCTGG - Intergenic
1138776565 16:59730127-59730149 GAGGGGCTACAGACAAAAGCTGG + Intronic
1143401061 17:6642710-6642732 GAAGCTCCACAGACTAAAACAGG - Intronic
1144117115 17:12107236-12107258 AAGGCTTTACAGAACAGAGCAGG + Intronic
1160325014 18:77938021-77938043 GAGGTTCTTCAGACCAGAACTGG + Intergenic
1161104178 19:2435021-2435043 GCGGCTCTACAAGCTGGAGCTGG - Exonic
1163247193 19:16103931-16103953 GAGCCACTAAAGACTAGAGGAGG + Intergenic
1163546499 19:17943917-17943939 GAGGCTCTACACACACGCGCCGG - Exonic
925396324 2:3536100-3536122 GAGGGCCCAGAGACTAGAGCAGG + Intronic
926400505 2:12491648-12491670 GAGACTTCACAGACCAGAGCTGG + Intergenic
942893121 2:181016601-181016623 GGGGGTCAACAGACTTGAGCTGG - Intronic
945039677 2:205733504-205733526 GAGGCTCTGCAAACCGGAGCAGG - Intronic
946362144 2:219225411-219225433 CTGGCACTACAGACTTGAGCAGG + Exonic
1177920498 21:27146324-27146346 GAGGCCCTGCAGACTTCAGCTGG - Intergenic
1179179155 21:39030660-39030682 GAGGCTCAAAAGAGCAGAGCTGG - Intergenic
1181798890 22:25331122-25331144 CAGGCTCTCCAGACAAAAGCAGG - Intergenic
1182480755 22:30607246-30607268 GAGGCTCTCCTGACCACAGCTGG - Exonic
1182689181 22:32144620-32144642 GAGGTTCTCCAGACAAAAGCAGG + Intergenic
1183302219 22:37063939-37063961 GAGGCCCTCCAGGCTTGAGCTGG - Intergenic
1184053838 22:42030753-42030775 GAGACTCAACCAACTAGAGCAGG + Intronic
953021962 3:39120347-39120369 CAGGCACTAGAGGCTAGAGCTGG - Intronic
954452903 3:50581237-50581259 GAGTCTGCACAGACCAGAGCTGG - Exonic
954735004 3:52699991-52700013 GACACTCTAGTGACTAGAGCAGG + Intronic
960530757 3:118761697-118761719 GATGCCTTACAGACTGGAGCTGG + Intergenic
960765587 3:121126382-121126404 GAGGGTTTACAGACTAGGACAGG - Intronic
967805213 3:193709719-193709741 GTGGCTCCACAGAGCAGAGCTGG - Intergenic
968574095 4:1356995-1357017 GAGGGTCCACAGAGCAGAGCGGG + Intronic
972696554 4:41452071-41452093 GAGGCTCTACAGACTAGAGCTGG - Intronic
973769269 4:54191696-54191718 GAGGCCCTACAGTCAAGAGGTGG - Intronic
974429930 4:61783019-61783041 CAGGCTCCACTGACTAGACCTGG + Intronic
979073530 4:116241460-116241482 CAAGCTGTACAGCCTAGAGCTGG + Intergenic
985875467 5:2591047-2591069 GAGGCTCTGCAGACAGGAGGGGG + Intergenic
992831650 5:80599040-80599062 GAGGCTCCACAGAGTTGAGGTGG - Intergenic
993550816 5:89271548-89271570 CAGGGGCTACAGACTCGAGCAGG - Intergenic
994578576 5:101611240-101611262 CAGGAGCCACAGACTAGAGCAGG - Intergenic
999344846 5:150807976-150807998 AAGGCTCTAAACATTAGAGCAGG - Intergenic
1005377321 6:25196596-25196618 GAGGCTGTACAGAAAAGAGTTGG - Intergenic
1005399050 6:25412812-25412834 GAGGCTATACAGCCTAGTGTAGG - Intronic
1008840711 6:55900026-55900048 CTGCCTCTACAGACCAGAGCTGG + Intergenic
1009813666 6:68702580-68702602 GCTGCTCTACAGAGTAAAGCAGG + Intronic
1016061497 6:139635950-139635972 GGGGCTCTACAGTCAACAGCTGG + Intergenic
1021185285 7:17556971-17556993 GATGCTCTTCATACTAGACCAGG + Intergenic
1022074444 7:26953642-26953664 GAGGCTCTACGGAAGTGAGCAGG + Intronic
1030317896 7:108135199-108135221 AAGGCTTTACAGACTAGATGTGG - Intergenic
1037933599 8:22899320-22899342 AAGGCTCCACAGACAGGAGCTGG - Intronic
1039686074 8:39802624-39802646 GAGCCCCTACAAACTGGAGCTGG + Intronic
1041894202 8:62905096-62905118 GAGACTGTTCAGACTAGAGATGG + Intronic
1042409187 8:68442757-68442779 GAAGCTCTTCAGAGTTGAGCAGG + Intronic
1055377195 9:75661689-75661711 CAAGCTCTACAGACAAGAGATGG - Intergenic
1057537331 9:95925144-95925166 GAGGCTATAAAGATTATAGCAGG - Intronic
1060827525 9:126695420-126695442 GGGGCTCAACAGGCCAGAGCAGG - Intronic
1061890458 9:133616584-133616606 GATGCTCCACAGGCCAGAGCTGG + Intergenic
1189375625 X:40464400-40464422 GAGGCTCTACGGGCCAGACCCGG - Intergenic
1201338307 Y:12904148-12904170 GAGGCTCGACAGACTTGACAGGG - Exonic