ID: 972697658

View in Genome Browser
Species Human (GRCh38)
Location 4:41463924-41463946
Sequence CTGGAGTTTGAGATCAGACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76801
Summary {0: 2, 1: 68, 2: 2625, 3: 27108, 4: 46998}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972697658_972697668 26 Left 972697658 4:41463924-41463946 CCCAGTCTGATCTCAAACTCCAG 0: 2
1: 68
2: 2625
3: 27108
4: 46998
Right 972697668 4:41463973-41463995 CTCACAAAGTGCTGGGATTACGG 0: 41
1: 4515
2: 4845
3: 3584
4: 3602
972697658_972697665 18 Left 972697658 4:41463924-41463946 CCCAGTCTGATCTCAAACTCCAG 0: 2
1: 68
2: 2625
3: 27108
4: 46998
Right 972697665 4:41463965-41463987 AGCTTAGCCTCACAAAGTGCTGG 0: 1
1: 33
2: 2615
3: 73759
4: 239465
972697658_972697666 19 Left 972697658 4:41463924-41463946 CCCAGTCTGATCTCAAACTCCAG 0: 2
1: 68
2: 2625
3: 27108
4: 46998
Right 972697666 4:41463966-41463988 GCTTAGCCTCACAAAGTGCTGGG 0: 1
1: 128
2: 7742
3: 208627
4: 313808

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972697658 Original CRISPR CTGGAGTTTGAGATCAGACT GGG (reversed) Intronic
Too many off-targets to display for this crispr