ID: 972698283

View in Genome Browser
Species Human (GRCh38)
Location 4:41469079-41469101
Sequence GTGGATGCACAGATGACTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 151}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972698283_972698293 28 Left 972698283 4:41469079-41469101 CCAAGAGTCATCTGTGCATCCAC 0: 1
1: 0
2: 0
3: 10
4: 151
Right 972698293 4:41469130-41469152 GAGGTGGGAATTAGTAATCTGGG 0: 1
1: 0
2: 0
3: 16
4: 160
972698283_972698288 9 Left 972698283 4:41469079-41469101 CCAAGAGTCATCTGTGCATCCAC 0: 1
1: 0
2: 0
3: 10
4: 151
Right 972698288 4:41469111-41469133 GGATGATAATTCCTTTTATGAGG 0: 1
1: 0
2: 5
3: 18
4: 251
972698283_972698290 13 Left 972698283 4:41469079-41469101 CCAAGAGTCATCTGTGCATCCAC 0: 1
1: 0
2: 0
3: 10
4: 151
Right 972698290 4:41469115-41469137 GATAATTCCTTTTATGAGGTGGG 0: 1
1: 0
2: 3
3: 27
4: 876
972698283_972698289 12 Left 972698283 4:41469079-41469101 CCAAGAGTCATCTGTGCATCCAC 0: 1
1: 0
2: 0
3: 10
4: 151
Right 972698289 4:41469114-41469136 TGATAATTCCTTTTATGAGGTGG 0: 1
1: 0
2: 1
3: 14
4: 242
972698283_972698292 27 Left 972698283 4:41469079-41469101 CCAAGAGTCATCTGTGCATCCAC 0: 1
1: 0
2: 0
3: 10
4: 151
Right 972698292 4:41469129-41469151 TGAGGTGGGAATTAGTAATCTGG 0: 1
1: 0
2: 0
3: 12
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972698283 Original CRISPR GTGGATGCACAGATGACTCT TGG (reversed) Intronic
903896018 1:26605270-26605292 TTGGATGCAATGCTGACTCTTGG - Intergenic
908509608 1:64840995-64841017 GTGTATGCACACGGGACTCTGGG - Intronic
912350130 1:109004683-109004705 GTTGATGCACAGAGGCCTATCGG - Exonic
913380988 1:118209919-118209941 GTGTATGCACAGAGCACTCCTGG + Intergenic
913484678 1:119323132-119323154 GTGTAAGCTCAGATGACTTTAGG + Intergenic
915098665 1:153483025-153483047 GTGGATGAAGAGAAGACTGTTGG - Intergenic
917837183 1:178950685-178950707 GTGGTTGAACAGTTGATTCTGGG + Intergenic
918287352 1:183070436-183070458 GTGGATGCCCAGATGTTCCTGGG + Intronic
919028235 1:192204684-192204706 GTTAATCCACAGATGACACTAGG + Intergenic
920674714 1:208030941-208030963 CTGGTTGCAGAGATGACTTTAGG + Intronic
921917925 1:220633599-220633621 GGGGATGCACAGCATACTCTGGG + Intronic
1066640916 10:37553332-37553354 CTGCATTAACAGATGACTCTAGG + Intergenic
1067175079 10:43940021-43940043 GTGGAGGCAGAGATTACTGTGGG + Intergenic
1068566538 10:58581966-58581988 GTATATGCACAGATGACCTTGGG - Intronic
1068738902 10:60446920-60446942 TTTGATCCACAGATTACTCTGGG + Intronic
1069792556 10:71032303-71032325 GTGGATGCAGAGACAACTCAGGG + Intergenic
1069869529 10:71524732-71524754 GTGGATGCAGAGGTGAGTGTTGG + Intronic
1070129842 10:73648343-73648365 GTGGGAGCACAGCTGCCTCTGGG + Exonic
1070339161 10:75480918-75480940 GAGGAGTCACAGCTGACTCTTGG + Intronic
1071840260 10:89463097-89463119 CTGGGTCCCCAGATGACTCTGGG + Intronic
1073146172 10:101283335-101283357 GTGGATGCATATGTGCCTCTGGG - Intergenic
1074058896 10:109946948-109946970 GAAGATGCACAGATGAATCGTGG - Intronic
1074272366 10:111967108-111967130 GTGGATAGTCAGATCACTCTTGG + Intergenic
1075259797 10:120953353-120953375 GTAGATACACAGATGGCTGTGGG - Intergenic
1076212587 10:128660321-128660343 CTGGCTGCACAGTTGACACTTGG + Intergenic
1077135431 11:995764-995786 GGGGCTGCACAGAGGACACTAGG - Intronic
1077459482 11:2701482-2701504 CTGGTTGCACAGCTGCCTCTCGG - Intronic
1077771775 11:5226854-5226876 GTGGAGACAGAGAAGACTCTTGG - Intronic
1079481402 11:20884476-20884498 TTGGATGCTCAGAAGATTCTGGG - Intronic
1086630611 11:89014545-89014567 GTGGAGGCACAGATGATTAATGG + Intronic
1088787403 11:113194655-113194677 GCGGAGGGAAAGATGACTCTTGG - Intronic
1089093684 11:115900091-115900113 TTGAATGCACTGGTGACTCTGGG + Intergenic
1090834698 11:130445881-130445903 GAGAATGCACATATAACTCTTGG + Intergenic
1097141101 12:56903026-56903048 CTGGAGACCCAGATGACTCTGGG + Intergenic
1099551529 12:84050866-84050888 GTGTTTCCACAGATGTCTCTTGG - Intergenic
1099575539 12:84375475-84375497 GTGTATGAACACATGACTATTGG - Intergenic
1099609047 12:84842631-84842653 GTGGTTTCACAGATCACTTTTGG + Intergenic
1100693257 12:97062504-97062526 GAGGGTGCAGAGATGACTATTGG - Intergenic
1103373703 12:120438668-120438690 GTGGATGGACAGCTGACACTTGG + Intronic
1104155365 12:126126147-126126169 GTGGGTGCACAGATGATGCTGGG + Intergenic
1106639169 13:31564931-31564953 GAGGATCCAAAGATGGCTCTGGG + Intergenic
1107458417 13:40577071-40577093 GTGGATGCACAGGAGATTCAGGG + Intronic
1107813391 13:44221096-44221118 GGGGATTCACAGAGGACTCACGG - Intergenic
1113980495 13:114270668-114270690 GGGGATTCACACTTGACTCTTGG + Intronic
1116691404 14:48111387-48111409 ATTGATACACAGATGACTCTTGG + Intergenic
1117674054 14:58138256-58138278 GAGGCTGCACAGGTGGCTCTGGG - Exonic
1119632808 14:76248741-76248763 CTGGAAGCAGAGAGGACTCTGGG + Intronic
1119673913 14:76539489-76539511 TTGGATGTTCAGTTGACTCTTGG + Intergenic
1124811642 15:32944906-32944928 GTGAATGCACTGATGTCTCTTGG - Intronic
1127011000 15:54628047-54628069 GTGGATGAAAACATGACTTTTGG - Exonic
1127054292 15:55115927-55115949 GTGCATGCACAGTGGCCTCTTGG + Intergenic
1127311498 15:57755621-57755643 GTGGAGGCAGAGATGACATTGGG - Intronic
1129636064 15:77319509-77319531 TTGGATGCAGAGAAGATTCTAGG + Intronic
1130055674 15:80523364-80523386 GTGCATGCACAGGTGACTATGGG + Intronic
1130909811 15:88263247-88263269 GTGGCGGCACATATAACTCTGGG - Intergenic
1136057101 16:27698616-27698638 GTGGAAACACGGATGAGTCTGGG - Intronic
1136777344 16:32879022-32879044 GGGGATGAGCAGGTGACTCTGGG - Intergenic
1136893281 16:33982491-33982513 GGGGATGAGCAGGTGACTCTGGG + Intergenic
1203079757 16_KI270728v1_random:1141131-1141153 GGGGATGAGCAGGTGACTCTGGG - Intergenic
1144811889 17:18005833-18005855 GGTGATGCACAGATGTCACTGGG + Intronic
1145849252 17:28075673-28075695 GAGGGTGCACATTTGACTCTGGG - Intronic
1146595213 17:34162452-34162474 CTGGGTGCACAGATTCCTCTTGG - Intronic
1148326030 17:46783989-46784011 GTGGATGCTAAGGAGACTCTGGG + Intronic
1149530554 17:57391593-57391615 GAAGATGCACAGATGACTCACGG - Intronic
1151828126 17:76534991-76535013 TTGGAAGCCCAGATGCCTCTGGG - Intronic
1152493750 17:80655792-80655814 GTGTATGCACATATGACTGATGG + Intronic
1152888583 17:82867011-82867033 GTGTCTGCACAGCTGTCTCTGGG + Intronic
1155145859 18:23082905-23082927 TTGGATTCGCAGATGACTTTGGG + Intergenic
1155230802 18:23773092-23773114 GTAAATGCACACATGACCCTTGG + Intronic
1161427617 19:4212565-4212587 GTGGAGGCTCAGCTGCCTCTGGG - Intronic
1162319257 19:9961051-9961073 GTGGATGTTCAGGTGACTCTTGG - Intronic
1162535296 19:11260070-11260092 ATGGATGAACAGATGAATATAGG + Intronic
1163304581 19:16469877-16469899 TTGGGTTCACAGATAACTCTGGG - Intronic
1165703021 19:37952929-37952951 GTGTATGCACAGAGGATTCTTGG + Intronic
1168311484 19:55463221-55463243 GTGGATGCCCAGATGGGGCTAGG + Intergenic
925273885 2:2635520-2635542 GTAAATGCAAAGATGACCCTGGG - Intergenic
929047965 2:37808871-37808893 GTGGTTGCACAGATGAGCCCAGG + Intergenic
929732072 2:44505765-44505787 AAGGAAGCACAGTTGACTCTTGG - Intronic
930243773 2:48962773-48962795 GTGGAACCACTGGTGACTCTGGG + Exonic
932420096 2:71596545-71596567 TTAAATGCACAGATGCCTCTGGG + Intronic
936092820 2:109511972-109511994 GTTGCTGCCCAGAGGACTCTGGG + Intergenic
937155529 2:119716111-119716133 TTGGCGGCACAGATCACTCTCGG - Intergenic
943963626 2:194301522-194301544 AATGATGCACAGATGACTCCAGG + Intergenic
946009036 2:216550069-216550091 GAGGAATCACAGATGCCTCTTGG - Intronic
947126415 2:226873574-226873596 GTTGGTGCAGTGATGACTCTGGG + Intronic
947290412 2:228567841-228567863 GTGGATAGACAGATAATTCTGGG - Intergenic
1171300150 20:24052841-24052863 GTGGATGCACAGCTCTCACTGGG + Intergenic
1178626423 21:34222630-34222652 GTGGCTGCAGTGAGGACTCTGGG + Intergenic
1179041819 21:37809859-37809881 GTGGATCCCCAGGTCACTCTGGG - Intronic
1179373583 21:40829082-40829104 GTGGTTGAACACATGACCCTGGG - Intronic
1181330340 22:22086164-22086186 GGGAATGCACAGCTGGCTCTGGG + Intergenic
1181403076 22:22663404-22663426 GTGGTTTCAGAGATGAATCTGGG + Intergenic
1181415760 22:22757705-22757727 ATGGTTTCAGAGATGACTCTAGG + Intronic
1181687731 22:24541245-24541267 TTTGGAGCACAGATGACTCTGGG - Intronic
1182985039 22:34708226-34708248 ATGGATGCACAGGACACTCTTGG - Intergenic
1184399198 22:44263944-44263966 GTGAATGCACACATCTCTCTTGG - Intronic
1185169124 22:49282088-49282110 CTGGAGGCAGAGATGACTCAGGG + Intergenic
952609070 3:35185342-35185364 GTGGATGCAGAAATGGCTGTGGG - Intergenic
953441939 3:42925715-42925737 GGTGAAGCACAGATGAATCTAGG - Intronic
954558320 3:51535730-51535752 GTGTATGCATAAATCACTCTAGG + Intergenic
955497396 3:59548409-59548431 GTGGCTGCAGAGATAACTTTAGG - Intergenic
959088368 3:101875804-101875826 GTGGATGGACAGGTAACTGTGGG - Intergenic
961017979 3:123482133-123482155 GTGGTTGCACAGCTTAATCTGGG - Intergenic
961025903 3:123557207-123557229 TTGAATGCACAGTTGACACTAGG - Intronic
961606213 3:128097321-128097343 TTGGATGCAAAGATGACGATGGG + Exonic
963062544 3:141236088-141236110 ACGCATGCACAGATGACTGTGGG - Intronic
965180491 3:165396412-165396434 GTGGAAGATCAGATGACTGTAGG - Intergenic
966800850 3:183762538-183762560 GTGGAGGCAGAGCTGACTCATGG + Intronic
968907597 4:3461888-3461910 GTGGCTGCACAGGTGACTGCGGG + Intergenic
969492215 4:7505925-7505947 GTGGAGGCACAGAAGACTAGGGG - Intronic
970837697 4:20430667-20430689 TTGGATGCAGAAATGATTCTAGG - Intronic
972152884 4:36117025-36117047 GTGGATGTAAAGAGGACTGTTGG - Intronic
972698283 4:41469079-41469101 GTGGATGCACAGATGACTCTTGG - Intronic
979440015 4:120740534-120740556 GAGGAGTCACAGATGAATCTAGG - Intronic
980403153 4:132320162-132320184 GGGGATGAACAGATGGATCTGGG + Intergenic
982164939 4:152605611-152605633 ATGGATGCAAAGATGACATTCGG + Intergenic
984698863 4:182805917-182805939 GTGGATGCAAAGATAGTTCTGGG - Intergenic
985671025 5:1206765-1206787 GGGGATGCTCACATGACACTGGG - Intronic
986966812 5:13283279-13283301 GTGGATGTACATATGGCTTTTGG - Intergenic
987145391 5:14986674-14986696 GTTTATGGACTGATGACTCTTGG - Intergenic
988440211 5:31225227-31225249 TTTGATGCATAAATGACTCTGGG + Intronic
990288554 5:54325931-54325953 GAGGAGGCAAAGATGTCTCTAGG + Intergenic
991517081 5:67449325-67449347 GAGGATGCACCAATGACTGTTGG + Intergenic
994133613 5:96260338-96260360 GTGGATACACAGAACATTCTTGG + Intergenic
997580978 5:135016860-135016882 GTGGTTGCACAGACGGGTCTTGG + Intergenic
1001379317 5:171293136-171293158 GAGGAGGCAGGGATGACTCTGGG - Intronic
1002066314 5:176653687-176653709 CTGGATCCAGAGCTGACTCTTGG - Intronic
1002336991 5:178486610-178486632 GTGAAAGCAGAGGTGACTCTTGG + Intronic
1004226870 6:13793299-13793321 ATGGGTGCACAGATGTCTGTTGG - Intronic
1005251187 6:23948348-23948370 GTGGAAGATCAGATGACTGTAGG - Intergenic
1006977709 6:38119061-38119083 CTGAATGCCCAGCTGACTCTAGG - Intronic
1011627622 6:89296406-89296428 CTGGATGCCCAGATGTCACTTGG - Intronic
1013217703 6:108044249-108044271 GTGGTTTCAAAAATGACTCTAGG + Exonic
1016055872 6:139577304-139577326 GTGGAAGCACAGAGCATTCTGGG + Intergenic
1019498528 7:1352676-1352698 GTGGCTGCCCAGATTCCTCTTGG - Intergenic
1022778584 7:33554499-33554521 GAGGAAGCAAAGATGACTCCTGG + Intronic
1031077333 7:117225536-117225558 GAAGATGCAGAGAAGACTCTGGG - Intronic
1033153649 7:138937779-138937801 GTGGATGGAAATGTGACTCTAGG + Intronic
1035175502 7:157047167-157047189 GAAGAAGCACAGATGACCCTCGG + Intergenic
1037753663 8:21698123-21698145 CTGGAGCCACAGATGCCTCTAGG - Intronic
1038646517 8:29366357-29366379 GAGGAATCACAGATGGCTCTGGG - Intergenic
1039194647 8:35017507-35017529 GTGGCTGCACAAATGGCTGTGGG - Intergenic
1041532789 8:58890652-58890674 GTGGATGCATAGATAACGTTAGG + Intronic
1042446965 8:68895844-68895866 GGGGAGGCATAGATGAGTCTTGG - Intergenic
1042670654 8:71259317-71259339 GTGTGTCCACAGGTGACTCTTGG - Intronic
1043888925 8:85634618-85634640 CTGGTAGCACAGTTGACTCTGGG - Intergenic
1045327063 8:101125293-101125315 GTGCAGGCACAGATGTCTCTGGG - Intergenic
1048537683 8:135312834-135312856 GTGGATGCACAGAAGACAAGAGG - Intergenic
1049918244 9:338957-338979 GTAGATGCACCTTTGACTCTTGG - Intronic
1055589249 9:77793352-77793374 ATGCATGAACAGGTGACTCTCGG + Intronic
1058333079 9:103789417-103789439 GTGGATGTACGTATTACTCTTGG - Intergenic
1059086353 9:111306900-111306922 GAGGATACAAGGATGACTCTGGG - Intergenic
1059377350 9:113894445-113894467 GTGGAGGGAAAGATGAATCTTGG + Intronic
1059744837 9:117189848-117189870 AGGGATGCACAGATTAGTCTAGG - Intronic
1060061634 9:120465904-120465926 GTGGATGCACACATCTCTCCTGG - Intronic
1062327290 9:136018326-136018348 CTGGGTGCAAAGGTGACTCTGGG - Intronic
1186637096 X:11418201-11418223 GTGGGTGCACAGAAGACTCAAGG + Intronic
1188002571 X:24995992-24996014 GTGGAGGCACAGAGGAAGCTGGG - Exonic
1193042401 X:77017405-77017427 GTCCATGCACTGTTGACTCTGGG - Intergenic
1195617222 X:106921854-106921876 TTGGAGGTACAGAGGACTCTAGG - Intronic
1197647547 X:129034247-129034269 GTGCATGGACAGATAACTCCAGG + Intergenic
1200660608 Y:5952014-5952036 GTGGGTCCACAGGTGACACTGGG - Intergenic