ID: 972699241

View in Genome Browser
Species Human (GRCh38)
Location 4:41477859-41477881
Sequence TTAAATGAACACTTAAATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 350
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 321}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972699241_972699243 3 Left 972699241 4:41477859-41477881 CCAGGATTTAAGTGTTCATTTAA 0: 1
1: 0
2: 2
3: 26
4: 321
Right 972699243 4:41477885-41477907 TATACCATGAAGTAGGCATGTGG 0: 1
1: 0
2: 0
3: 12
4: 119
972699241_972699245 5 Left 972699241 4:41477859-41477881 CCAGGATTTAAGTGTTCATTTAA 0: 1
1: 0
2: 2
3: 26
4: 321
Right 972699245 4:41477887-41477909 TACCATGAAGTAGGCATGTGGGG 0: 1
1: 0
2: 0
3: 8
4: 177
972699241_972699247 27 Left 972699241 4:41477859-41477881 CCAGGATTTAAGTGTTCATTTAA 0: 1
1: 0
2: 2
3: 26
4: 321
Right 972699247 4:41477909-41477931 GATCACAGCTACCACCTTAATGG 0: 1
1: 0
2: 0
3: 9
4: 99
972699241_972699244 4 Left 972699241 4:41477859-41477881 CCAGGATTTAAGTGTTCATTTAA 0: 1
1: 0
2: 2
3: 26
4: 321
Right 972699244 4:41477886-41477908 ATACCATGAAGTAGGCATGTGGG 0: 1
1: 0
2: 0
3: 10
4: 157
972699241_972699248 30 Left 972699241 4:41477859-41477881 CCAGGATTTAAGTGTTCATTTAA 0: 1
1: 0
2: 2
3: 26
4: 321
Right 972699248 4:41477912-41477934 CACAGCTACCACCTTAATGGTGG 0: 1
1: 0
2: 0
3: 12
4: 101
972699241_972699242 -4 Left 972699241 4:41477859-41477881 CCAGGATTTAAGTGTTCATTTAA 0: 1
1: 0
2: 2
3: 26
4: 321
Right 972699242 4:41477878-41477900 TTAAAAATATACCATGAAGTAGG 0: 1
1: 0
2: 3
3: 59
4: 797

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972699241 Original CRISPR TTAAATGAACACTTAAATCC TGG (reversed) Intronic
902790381 1:18763801-18763823 TTCAATGAGCACATAAATGCGGG + Intergenic
906372791 1:45268880-45268902 TGATATGAACAATAAAATCCAGG + Intronic
907692686 1:56685487-56685509 TTTAATGAAATCTTAAATGCTGG - Intronic
907972698 1:59399358-59399380 ATAAATAATCACTTATATCCTGG - Intronic
908713690 1:67047110-67047132 TTATATGAACACTAAAGTACAGG + Intronic
909328814 1:74387982-74388004 TTTAAAGAACACTTAAGGCCGGG + Intronic
909510465 1:76447122-76447144 GTATATGGACAATTAAATCCAGG + Intronic
909686945 1:78359963-78359985 TTAAAAGAAAACTGAAATCAAGG - Intronic
910110936 1:83682669-83682691 TTAAAAGATGACTTAAATACTGG + Intergenic
910233311 1:85008706-85008728 TGATATGAACAATGAAATCCAGG - Intronic
910256219 1:85249694-85249716 TGATATGAACAATGAAATCCAGG - Intergenic
911076382 1:93879305-93879327 TGAAATGCACACTTAAACCCAGG - Intronic
914745958 1:150501211-150501233 TGAGATGATCACTTGAATCCAGG + Intronic
914860904 1:151385316-151385338 TTAAATGAACTAGTAAGTCCAGG + Intergenic
915027713 1:152847848-152847870 TTAAATGAAAATTTAAAGTCAGG - Intergenic
915664418 1:157431667-157431689 TTAAGTGGACATTTAAGTCCTGG + Intergenic
916654647 1:166863730-166863752 TTAAATGAATATTAAAATACTGG - Intronic
916872212 1:168927989-168928011 GGAAATGAACACATAAATTCTGG + Intergenic
917344149 1:174011471-174011493 CTAAATGAAAGCTGAAATCCAGG + Intronic
918293481 1:183132596-183132618 TTCAATGAAAAATTAAATGCTGG + Intronic
918435578 1:184508840-184508862 TAACATTAACACTTAAATCCAGG + Intronic
918591998 1:186250368-186250390 TGATATGAACAATGAAATCCAGG - Intergenic
919442518 1:197654633-197654655 TTGATTGAACCCTGAAATCCTGG - Intronic
921386620 1:214576536-214576558 TGATATGAACAATGAAATCCAGG + Intergenic
921763101 1:218939960-218939982 TTATATGGACAATGAAATCCAGG + Intergenic
921870630 1:220135788-220135810 TTAAATGAAAAAATAAAACCAGG - Intronic
923932751 1:238721457-238721479 TGATATGAACAATGAAATCCGGG + Intergenic
1064456377 10:15491042-15491064 CTAAAAGAACACATGAATCCAGG - Intergenic
1064880457 10:20046561-20046583 TAAAATGATTACTGAAATCCAGG - Intronic
1066521876 10:36229299-36229321 CAAAATGAACACTCAAATCCAGG + Intergenic
1067694689 10:48526269-48526291 TTGAATGAAGACTTAACTCCTGG - Intronic
1067738142 10:48875051-48875073 TGAAAAGAAAAATTAAATCCTGG - Intronic
1068355915 10:55907982-55908004 TGATATGAACAGTGAAATCCAGG - Intergenic
1068362081 10:55988981-55989003 TAAAATGAACACACAAATCTAGG + Intergenic
1068941548 10:62685704-62685726 ACAAATGAACACTTAAATTCAGG + Intergenic
1070238865 10:74658095-74658117 TTGAATGAACTCTTAACTCTAGG - Intronic
1073942307 10:108712913-108712935 TGATATGAACAATGAAATCCAGG + Intergenic
1074227427 10:111498994-111499016 TTAAATGAACAATTTCATTCAGG + Intergenic
1077800226 11:5529425-5529447 TTATTTGTCCACTTAAATCCAGG - Intronic
1078420224 11:11205566-11205588 AAAAAAGAACACTCAAATCCTGG - Intergenic
1078518092 11:12041616-12041638 TAATATGAACAATGAAATCCAGG - Intergenic
1078761637 11:14256309-14256331 TCAAATGAACAATTTGATCCAGG + Intronic
1079542540 11:21593574-21593596 TGATATGAACAATAAAATCCAGG + Intergenic
1079700353 11:23538741-23538763 TTAAATAAACAGTGAAATCAAGG - Intergenic
1080452200 11:32387126-32387148 TTAAATGAAGAAATAAAACCCGG + Intergenic
1083101988 11:60317884-60317906 TGAAATGAAAACTTGAATGCTGG - Intergenic
1084915489 11:72426061-72426083 TCAAATGAATAAATAAATCCTGG + Intronic
1086184253 11:83994668-83994690 TTAAAACAACACTCAATTCCAGG + Intronic
1086250053 11:84802039-84802061 TTAAATGATCACCTAAATTATGG - Intronic
1086465106 11:87044962-87044984 TTAAATGAACAATTGAATAATGG + Intronic
1086549284 11:88036001-88036023 TTAAATTAAAATTAAAATCCAGG + Intergenic
1089093460 11:115898093-115898115 TTAACTGGACAATGAAATCCTGG + Intergenic
1089925601 11:122254377-122254399 TTAAAAGATCACTTAAGGCCAGG + Intergenic
1090394809 11:126411850-126411872 TTACCTGAACCTTTAAATCCGGG - Intronic
1090588482 11:128239136-128239158 TTAACAGGACACTTAATTCCAGG + Intergenic
1092652135 12:10646282-10646304 TGATATGAACAATGAAATCCAGG + Intronic
1092662753 12:10756210-10756232 TGATATGGACAATTAAATCCAGG - Intergenic
1093299985 12:17442324-17442346 TGATATGAACAATAAAATCCAGG + Intergenic
1093380867 12:18491346-18491368 TTAAATGAATTCTTGAATTCAGG - Intronic
1093757749 12:22871337-22871359 TTAAAGGAACACTTAAAAAAGGG - Intergenic
1094637593 12:32241532-32241554 TTAATTAAAAACTTAAAGCCAGG + Intronic
1095393437 12:41736139-41736161 TTCAATTAACATTTAAATCATGG + Intergenic
1096968936 12:55650039-55650061 TGATATGAACAATTAAGTCCAGG + Intergenic
1097498858 12:60377486-60377508 TGATATGAACAATGAAATCCAGG + Intergenic
1101059270 12:100954197-100954219 TTTATTGAACACTTCATTCCTGG - Intronic
1103295993 12:119887662-119887684 TTATATGAAAACTTAAAGCAGGG - Intergenic
1104621446 12:130316437-130316459 TTAGATCAACTCTTTAATCCTGG + Intergenic
1107074076 13:36301883-36301905 GAAAATGAACACTTAAATTGTGG + Exonic
1107858791 13:44641598-44641620 TTAAATGAGCAACTGAATCCAGG + Intergenic
1109334942 13:60981847-60981869 TGAAATGGACAATGAAATCCAGG - Intergenic
1109876181 13:68406514-68406536 TGATATGGACAATTAAATCCAGG - Intergenic
1110241171 13:73268824-73268846 TTACATGTACACAAAAATCCAGG + Intergenic
1110395835 13:75028716-75028738 TGATATGGACAATTAAATCCAGG + Intergenic
1111325907 13:86695576-86695598 TGATATGAACACTGAAGTCCAGG - Intergenic
1111530556 13:89532080-89532102 TTAAATGAACATGTATATACAGG + Intergenic
1111601710 13:90482460-90482482 TTATATGGACAATAAAATCCAGG - Intergenic
1112214378 13:97415187-97415209 TTAAATGATCAGCTAAAGCCAGG + Intergenic
1112548334 13:100393729-100393751 TTAATTGAACATCAAAATCCTGG + Intronic
1112654031 13:101429666-101429688 TTCATTGAAGACTTAATTCCAGG - Intergenic
1115199210 14:30835031-30835053 TGATATGAACAATGAAATCCAGG - Intergenic
1115986669 14:39109411-39109433 TAAAATTAACTCTTAAATTCTGG - Intronic
1115991566 14:39155534-39155556 TCAAATAAACAAATAAATCCGGG - Intronic
1116240273 14:42333223-42333245 TTGAATGAACAATTAAACACAGG + Intergenic
1116287364 14:42989634-42989656 TTAAATGAGCACTAAATTTCAGG - Intergenic
1116971382 14:51069629-51069651 TTAAAGCAACACTTAAAATCAGG + Intronic
1117180661 14:53188010-53188032 TTTATTGAACCCCTAAATCCAGG + Intergenic
1117604242 14:57409758-57409780 GCAAATGAACACATAAATCTTGG - Exonic
1118396437 14:65340989-65341011 TTAAATCAAGACTTCAATACAGG + Intergenic
1119499925 14:75116718-75116740 TGAAATGATCACTTGAACCCGGG - Intronic
1120147715 14:80997575-80997597 TAAAATGATCATTTAAACCCTGG + Intronic
1120418015 14:84244178-84244200 TGATATGAACAATGAAATCCAGG - Intergenic
1120690530 14:87587953-87587975 TTATGTGAACACTGAAATTCTGG + Intergenic
1121595734 14:95160667-95160689 TTAAAGGTATATTTAAATCCTGG - Intergenic
1121944347 14:98104780-98104802 TAAATTGAACACTTTATTCCAGG - Intergenic
1122131671 14:99607475-99607497 CTAAATGAACACACACATCCTGG - Intergenic
1122733584 14:103821156-103821178 CAAAATGAAGACTAAAATCCAGG + Intronic
1123963355 15:25430772-25430794 TTAAATAATTTCTTAAATCCTGG - Intronic
1125126705 15:36231953-36231975 TTAATTAGAGACTTAAATCCAGG - Intergenic
1125274063 15:37971843-37971865 TGATATGAACAATGAAATCCAGG - Intergenic
1126022414 15:44415674-44415696 TCAAATTAACACTTAATTCAGGG - Exonic
1126179904 15:45775219-45775241 TTTAATGAGCTCTTAATTCCAGG - Intergenic
1126203257 15:46013988-46014010 TTAAAAAAAAACTAAAATCCTGG - Intergenic
1126447872 15:48770046-48770068 TTAAATGAACAGATAAATCTGGG - Intronic
1128077293 15:64835551-64835573 ATAAATTAAAACATAAATCCAGG - Intergenic
1128641956 15:69345739-69345761 TTAAATGAAATCTTACATTCAGG + Intronic
1129953275 15:79610677-79610699 TTTAATGAAGACTTAAAGCAGGG - Intergenic
1131362124 15:91802521-91802543 TTAAATCCACACTTAAACCTTGG - Intergenic
1131724429 15:95206356-95206378 TTATATGGACAATGAAATCCAGG + Intergenic
1131850391 15:96536840-96536862 TTAAATGAAAGCTTAAATGGGGG + Intergenic
1133891913 16:9887185-9887207 TTAAAAAAAAACCTAAATCCGGG - Intronic
1137085615 16:36118363-36118385 TTAAAGGAAGCCTTAAATCTAGG + Intergenic
1137316863 16:47334464-47334486 TTAAACAAACACTTAAATATAGG + Intronic
1138866051 16:60821182-60821204 TAAAACGAAAACTTTAATCCAGG - Intergenic
1140677292 16:77344988-77345010 TTAAATTATGACTTAAGTCCAGG - Intronic
1140708458 16:77653700-77653722 TTCACTGAGCACTTAACTCCAGG - Intergenic
1141385213 16:83616145-83616167 GTGTATGAACAATTAAATCCAGG - Intronic
1141849479 16:86635435-86635457 TTAAAGGCACACTAAAATCCTGG + Intergenic
1146734446 17:35225845-35225867 TGAAATGAGCACTTAATTCCTGG + Intergenic
1149052796 17:52326306-52326328 TGATATGAACAATGAAATCCAGG - Intergenic
1149079588 17:52638115-52638137 TTAAATGATCATTTAAACTCAGG + Intergenic
1150480785 17:65508044-65508066 TAAAATCAACATTTAAAGCCGGG + Intergenic
1152416348 17:80165017-80165039 TAAAATGAACAATTCAAGCCAGG - Intergenic
1153120557 18:1719649-1719671 TTAAATGAACATTTAAAAAATGG - Intergenic
1155243381 18:23884664-23884686 TTAAGTGAGCACTGAAACCCAGG - Intronic
1156043430 18:32850847-32850869 TTTTATGAACATTTATATCCAGG - Intergenic
1157406772 18:47428315-47428337 TTACAAGAACACTTAAATACTGG - Intergenic
1158850305 18:61489726-61489748 TCAACTGACCATTTAAATCCTGG + Intronic
1159270607 18:66144498-66144520 TTAAATGAACACTTAATAGGAGG - Intergenic
1159838729 18:73372031-73372053 TGATATGAACAATGAAATCCAGG + Intergenic
1164038305 19:21472829-21472851 TGAAATGATCACTTAAGCCCAGG - Intronic
1164317718 19:24108475-24108497 TTAAAAGAACTCTGAGATCCAGG - Intronic
1168441258 19:56369091-56369113 ATAAATGAACACTAAAGTACAGG - Intergenic
925015212 2:518804-518826 GTCAATTAACACTTAATTCCTGG + Intergenic
925527103 2:4814767-4814789 TGATATGAACAATGAAATCCAGG - Intergenic
926868876 2:17390964-17390986 TGATATGAACAATTAAGTCCAGG + Intergenic
928075097 2:28257236-28257258 TTAAGTGAACACTTAAATTTTGG + Intronic
929088903 2:38195370-38195392 TTTAATGAACACTTTATTTCTGG - Intergenic
930328843 2:49956810-49956832 TTAAATCAACAGTTATATACAGG - Intronic
930439164 2:51384943-51384965 TTAAATTAAGTCTTAAAACCAGG - Intergenic
932083662 2:68738354-68738376 TTATTTGAACACTGAAATGCTGG + Intronic
932285323 2:70526627-70526649 TTAAAGGAAAACAAAAATCCCGG + Intronic
933458782 2:82551704-82551726 TTCAATAAAAACTTAAAGCCTGG - Intergenic
933584718 2:84168273-84168295 TGACATGAACAGTGAAATCCAGG + Intergenic
933591290 2:84235331-84235353 TTAAATGAAAATCTAAATGCTGG + Intergenic
934011990 2:87830380-87830402 TGAAATGAACAATAAAATCCAGG - Intergenic
934892643 2:98084116-98084138 TTAAAAACACATTTAAATCCAGG + Intergenic
935077996 2:99764576-99764598 TAAAATGAACATTGAAAACCAGG - Intronic
936549549 2:113424902-113424924 TGAAATGAACATTTACATTCTGG + Intergenic
937008836 2:118543485-118543507 TGATATGAACACTGAAATCCAGG + Intergenic
937707419 2:124937221-124937243 TTAAATCAAGAATTAAATCAAGG + Intergenic
938219853 2:129556718-129556740 TTAAAAGACCATTTAAATCCTGG + Intergenic
938727845 2:134122481-134122503 TTAAATGAGCATTTAAAAGCAGG - Intronic
938868949 2:135453700-135453722 TTATATGAACAATAAGATCCAGG - Intronic
939011222 2:136847936-136847958 TTAAATGCACACTGGAATCTTGG - Intronic
939058186 2:137387716-137387738 TTAGTTGAACTCTTAAATCCTGG - Intronic
939322034 2:140636474-140636496 TTTAATGAATAATTAAATGCAGG - Intronic
939511228 2:143108034-143108056 TTAAATGAAATTTTAAATGCGGG - Intronic
942307097 2:174619349-174619371 TTAAGTGATCACTTGAGTCCAGG + Intronic
942553471 2:177146083-177146105 TTAAATGAACACTTCAATTCTGG + Intergenic
943017198 2:182528221-182528243 TGATATGAACAATGAAATCCAGG + Intergenic
943832208 2:192477582-192477604 TTATATGGACACTGAAGTCCAGG + Intergenic
944328408 2:198435336-198435358 TTAAATAAACATTTAAATTCTGG - Intronic
944908831 2:204289382-204289404 TTAAATGAACCCTATGATCCAGG + Intergenic
945692330 2:213053426-213053448 TTAATTGAATATTTAAATGCAGG - Intronic
945706445 2:213239691-213239713 TTAAATCAAAACTAAAATCCTGG - Intergenic
945814116 2:214583000-214583022 TTAAATGACAACTTAGGTCCTGG + Intergenic
945856859 2:215079548-215079570 TTAAAGGAACAGTTAATTCAGGG + Intronic
946562561 2:220928952-220928974 TGATATGGACAATTAAATCCAGG - Intergenic
947004709 2:225497595-225497617 TTAAATGCACATATAAACCCAGG - Intronic
947054514 2:226085271-226085293 TGATATGGACAATTAAATCCAGG - Intergenic
1169007131 20:2217033-2217055 TTAAAAGAATACTTAAAGGCAGG - Intergenic
1169073273 20:2746679-2746701 TTAAATGAACATTCAAATTTGGG + Intronic
1169609589 20:7364128-7364150 TTACATGGACAATGAAATCCAGG + Intergenic
1170078859 20:12449782-12449804 TAAAATGGACAATAAAATCCAGG + Intergenic
1170543024 20:17407805-17407827 TTGAATGAAGACCTAGATCCTGG + Intronic
1172353153 20:34259775-34259797 ATAAATAAATACATAAATCCAGG + Intronic
1173058881 20:39642938-39642960 TTTAAAGAATCCTTAAATCCTGG + Intergenic
1173469452 20:43311416-43311438 TCAAAAGGACACTTAAACCCAGG - Intergenic
1173830708 20:46085325-46085347 TTAAATAAACAGTGAACTCCAGG - Intronic
1177095754 21:16830075-16830097 ATAAATGAAAATTTAAATTCGGG + Intergenic
1177648697 21:23933525-23933547 TAAAATAAAAACTTAAATGCCGG + Intergenic
1178511703 21:33210685-33210707 TCACATGAACACTTTAAACCTGG - Intergenic
1179065045 21:38017154-38017176 TAATATGAACAATGAAATCCAGG + Intronic
1179678336 21:43000060-43000082 TTATATGAACAGTAAAGTCCAGG - Intronic
1180607433 22:17069422-17069444 TTAAATTAAGACTTAAGTTCTGG - Intergenic
1180664893 22:17502909-17502931 ATAAATGAACACTAAGATGCAGG - Intronic
1183278412 22:36917102-36917124 TTAAATGAACAAACAAACCCTGG - Intronic
949662258 3:6292585-6292607 TTATATGAACAATGAAATCCAGG - Intergenic
951079454 3:18435071-18435093 TTAAATGAAAAATTACATGCCGG + Intronic
951305144 3:21051011-21051033 TTAAATGAGGACTTAAGTCTAGG - Intergenic
954225570 3:49178696-49178718 TTAAAGCAACACTTCAGTCCTGG + Intronic
955973642 3:64460677-64460699 TGAAATGCACAATTAAATGCAGG - Intergenic
956288282 3:67633975-67633997 TAAAATGAATACTTTATTCCAGG - Intronic
957150207 3:76476675-76476697 ATAAATAGACCCTTAAATCCTGG - Intronic
957518835 3:81292555-81292577 TTAAAAGAACACTAAAGGCCGGG - Intergenic
957932640 3:86901363-86901385 TTTAATGAACAGTGAAATCCAGG - Intergenic
959168385 3:102811643-102811665 TTAAATGAACATTTTATTTCAGG + Intergenic
959381137 3:105642327-105642349 TGACATGAACAATGAAATCCAGG - Intergenic
959491640 3:106996922-106996944 ATAGATTAACATTTAAATCCTGG + Intergenic
959624205 3:108431821-108431843 TGAAATGGACAATGAAATCCAGG + Intronic
959781364 3:110237987-110238009 TTCACTGAATACTTAAATTCAGG - Intergenic
960604326 3:119489462-119489484 TTAGATGAACAGGTAAAACCAGG + Intronic
963133626 3:141880020-141880042 TTAAATGAATGATAAAATCCTGG - Intronic
963540691 3:146583784-146583806 TTAAATGAACCCTAAAATATTGG - Intronic
963542656 3:146613381-146613403 TGTATTGAACACTAAAATCCTGG + Intergenic
963666057 3:148187783-148187805 TTCAATGACCACTTAAACACAGG - Intergenic
963682417 3:148395260-148395282 GTAAAGGAAAAGTTAAATCCTGG + Intergenic
965482887 3:169242326-169242348 TTCTTTTAACACTTAAATCCAGG + Intronic
965859734 3:173134161-173134183 TTAAATGAACATTTATATGTAGG - Intronic
966452664 3:180079275-180079297 TGATATGAACACTGAAGTCCAGG - Intergenic
966466354 3:180234540-180234562 TGATATGAACAATAAAATCCAGG - Intergenic
967622651 3:191651573-191651595 TTATATGGACAATAAAATCCAGG - Intergenic
968336724 3:197919902-197919924 TTAAATTAACATTTACAGCCAGG + Intronic
969996540 4:11318348-11318370 TGATATGAACAATAAAATCCAGG + Intergenic
970959363 4:21855069-21855091 TTAAATGACCTTTAAAATCCTGG - Intronic
971108305 4:23552295-23552317 TTAAAAGAACATTTAAATTTTGG + Intergenic
971235863 4:24841832-24841854 TTAAATGAACACTGAACTCAGGG + Intronic
971610098 4:28712995-28713017 TTACATGGACACTTATCTCCAGG + Intergenic
972133740 4:35865520-35865542 TCAATTGAACACTTGAACCCAGG + Intergenic
972699241 4:41477859-41477881 TTAAATGAACACTTAAATCCTGG - Intronic
972890099 4:43547567-43547589 TGTAATGAACACTTGAATCATGG - Intergenic
973223523 4:47755911-47755933 ATAAATGAACTCTTCAATCAGGG - Intronic
974171171 4:58269469-58269491 TGAAATGGACAATGAAATCCAGG + Intergenic
974438443 4:61886398-61886420 GTAAATGAACACTTAAAGGGTGG + Intronic
977395841 4:96469438-96469460 TGATATGAACAATGAAATCCAGG - Intergenic
978302188 4:107282912-107282934 TTAAATGTTCATTAAAATCCTGG - Intronic
978684092 4:111417568-111417590 TGAAATAAACACTTAAATTCTGG - Intergenic
978696420 4:111585194-111585216 TGATATGAACAATGAAATCCAGG - Intergenic
979368095 4:119848921-119848943 TGATATGAACAATGAAATCCAGG - Intergenic
980372013 4:131887135-131887157 TTTAATGAACATTTAAAACACGG + Intergenic
980466057 4:133183971-133183993 TTAAATTAAAATTTAAATCCAGG - Intronic
980758467 4:137196812-137196834 TTAAATGAACCTTTAGTTCCTGG + Intergenic
981121081 4:141051673-141051695 TGATATGAACAATGAAATCCAGG - Intronic
981359310 4:143829044-143829066 TAAAATGAAAACATGAATCCCGG + Intergenic
983679189 4:170332669-170332691 TTAAATGAACACATACAGGCAGG + Intergenic
984535226 4:180966565-180966587 TTTAATCATCACTTAAATCAAGG - Intergenic
984922600 4:184778731-184778753 TTGAATGAACTCATAAATACAGG + Intronic
987435157 5:17885075-17885097 TGATATGAACAATGAAATCCAGG + Intergenic
987488520 5:18549405-18549427 TGACATGAACAATTAAGTCCAGG - Intergenic
987663526 5:20907165-20907187 TGATATGAACAATGAAATCCAGG + Intergenic
988759157 5:34295022-34295044 TGATATGAACAATGAAATCCAGG - Intergenic
988911347 5:35846684-35846706 TGAAATGAACAATAAAGTCCAGG - Intergenic
989235299 5:39141427-39141449 GTAAATCAACACTTCAATTCTGG + Intronic
989736311 5:44711372-44711394 TTAATAGAAGCCTTAAATCCAGG + Intergenic
990024517 5:51169132-51169154 TAAAATGCACATTTTAATCCAGG + Intergenic
990716038 5:58637920-58637942 TTAAATATACATTGAAATCCTGG + Intronic
990994770 5:61720844-61720866 TCAAATGAAGACTTAGATCAGGG + Intronic
991104427 5:62828429-62828451 TTTAATGGACACTTAATTCCAGG + Intergenic
991639891 5:68741785-68741807 TTAAAAGAAAACTGAAATTCAGG + Intergenic
991669180 5:69030488-69030510 TAAAGTGTACACTTAAATGCTGG - Intergenic
992234124 5:74691344-74691366 ATAAATGGACACATAAATCAAGG + Intronic
992785352 5:80165199-80165221 TAAAAAAAAAACTTAAATCCAGG + Intronic
993200727 5:84812273-84812295 TGATATGAACAATAAAATCCAGG + Intergenic
993293719 5:86108448-86108470 TGATATGAACAGTGAAATCCAGG + Intergenic
993518117 5:88863074-88863096 TTAAATGATGAGTCAAATCCTGG - Intronic
995314154 5:110748694-110748716 TTAAATGAATACTTAAAGAGCGG - Intronic
996102561 5:119459530-119459552 ATAACAGAACACTTAAAACCGGG + Intronic
996179886 5:120406492-120406514 TGATATGGACAATTAAATCCAGG + Intergenic
996973488 5:129401688-129401710 GTACATGAACATTTTAATCCTGG - Intergenic
997092883 5:130877895-130877917 TGATATGAACAATGAAATCCAGG + Intergenic
997190434 5:131929314-131929336 TGAAATGGACATTTAGATCCAGG - Intronic
998264983 5:140661153-140661175 TTAGAGGAAAACTTCAATCCTGG - Intronic
998559105 5:143154618-143154640 TTCACTGATCACTTAAAGCCTGG - Intronic
999068421 5:148716590-148716612 TTACATGGACAATGAAATCCAGG + Intergenic
1000273135 5:159705878-159705900 TGAAATGAACATATAAATCCAGG + Intergenic
1000359440 5:160433588-160433610 TTAAATGAACACATAAAGATAGG - Intergenic
1000515378 5:162232167-162232189 TGATATGAACAATGAAATCCAGG + Intergenic
1000741380 5:164974154-164974176 TGATATGAACAATGAAATCCAGG + Intergenic
1001352185 5:170979999-170980021 TTATATGGACAGTGAAATCCAGG + Intronic
1002848857 6:973066-973088 TGAAAGGACCACTTAAATCCAGG + Intergenic
1003025405 6:2550705-2550727 TGAGATAAATACTTAAATCCTGG + Intergenic
1003217382 6:4126846-4126868 CTAAATGAACATTTAAAAACTGG - Intronic
1008000415 6:46354069-46354091 TTAAAAGGAAACTTAACTCCTGG - Intronic
1009438632 6:63648707-63648729 TTAAATGAACTTTTAAATTTAGG + Intronic
1009573807 6:65425786-65425808 TGAGATGACCAGTTAAATCCAGG - Intronic
1009602025 6:65813396-65813418 CTCAATTACCACTTAAATCCTGG - Intergenic
1011327727 6:86168839-86168861 TTAACTGAAAACATAAATACTGG - Intergenic
1012693278 6:102344933-102344955 TGATATGAACACTGAGATCCAGG - Intergenic
1012749843 6:103144734-103144756 TGATGTGAACAATTAAATCCAGG - Intergenic
1014105306 6:117554222-117554244 TTAAATGTACACATAAATATTGG - Intronic
1014385525 6:120796990-120797012 TTAAATGAACTCTTGAATACTGG + Intergenic
1014501832 6:122200999-122201021 TTAAATGTGCATTAAAATCCTGG - Intergenic
1014516620 6:122386637-122386659 GTAGAAGATCACTTAAATCCAGG + Intergenic
1014994845 6:128129445-128129467 TTAGGTGAATACTTAATTCCTGG - Intronic
1015402002 6:132797821-132797843 TTAATTTAACACTTATTTCCAGG + Intronic
1015954335 6:138584245-138584267 TTAAATGAACACTTCACAGCTGG + Intronic
1016069231 6:139718560-139718582 TCAAATGAACACTTGCATCATGG + Intergenic
1016230605 6:141799946-141799968 TTATATGGACAATGAAATCCAGG + Intergenic
1016639606 6:146333854-146333876 ATAAATGAACAGTGATATCCTGG + Intronic
1018667854 6:166156011-166156033 CCAAATGAACACCAAAATCCAGG + Intergenic
1020567924 7:9821424-9821446 TTAAATGGATACATAAATTCAGG + Intergenic
1022787449 7:33652603-33652625 TTAAAACAACACTGAAAGCCAGG - Intergenic
1024742754 7:52372706-52372728 TAAGAAGAACACTTGAATCCAGG - Intergenic
1024992179 7:55243851-55243873 TTTAATGAACACTAAAATTTTGG + Intronic
1027757540 7:82233503-82233525 TTAAATGAATACTTCAATAAAGG - Intronic
1027828447 7:83147153-83147175 GTATATTAACACATAAATCCAGG + Intronic
1028485878 7:91356672-91356694 GCAACTGAACAGTTAAATCCAGG - Intergenic
1028982122 7:96978955-96978977 TTAAATTAATACTTAAAGCATGG - Intergenic
1030108577 7:106007652-106007674 TGATATGGACAATTAAATCCAGG - Intronic
1030807281 7:113933254-113933276 TGATATGGACAATTAAATCCAGG - Intronic
1031193572 7:118586154-118586176 TGATATGAACAATGAAATCCAGG + Intergenic
1031332729 7:120486200-120486222 ATAAATGAAAACATAAAACCAGG + Intronic
1031528797 7:122852274-122852296 TTGAATGAACAGTTGAATTCAGG - Intronic
1031638013 7:124125641-124125663 TTAAATGAATACATAAATTTTGG + Intergenic
1032590477 7:133187534-133187556 TTAAATAAACAATGAAATGCAGG - Intergenic
1033730145 7:144170620-144170642 TGATATGAACAGTGAAATCCAGG + Intergenic
1034011378 7:147532395-147532417 TGACATGAACAATAAAATCCAGG - Intronic
1038205428 8:25459915-25459937 TTAAATGCACAATTAAATTATGG - Intronic
1038330714 8:26606910-26606932 TTAAATGAACACTCAAACTGCGG + Intronic
1038602944 8:28966311-28966333 ATAAAAGAACAATTAAATTCAGG - Intronic
1044022634 8:87125745-87125767 ATAAATGAACACTACAATTCAGG + Intronic
1044655844 8:94547572-94547594 TTAAATGACCTCTAAAATACAGG + Intronic
1045379240 8:101606613-101606635 TCAAATGCACTCTTAAGTCCAGG - Intronic
1046245427 8:111554999-111555021 TAAAATGAATATTTTAATCCAGG - Intergenic
1047117859 8:121865106-121865128 TGAAATGAACACTGAACCCCAGG - Intergenic
1047766638 8:127995262-127995284 TTAGATAAACACTCAAAGCCAGG - Intergenic
1047924414 8:129668982-129669004 TGATATGGACAATTAAATCCAGG + Intergenic
1048002428 8:130389905-130389927 TCAAATGAAAGCTTAAAGCCTGG - Intronic
1048677785 8:136803592-136803614 ATAAATTAATACTTAAATTCAGG - Intergenic
1049903395 9:191926-191948 TGAAATGAACATTTACATTCTGG - Intergenic
1050940440 9:11451229-11451251 TTATATGGACTCTGAAATCCAGG + Intergenic
1051729469 9:20125270-20125292 TAAAATGAATACATATATCCAGG - Intergenic
1052093537 9:24357801-24357823 TGATATGGACACTGAAATCCAGG - Intergenic
1052267506 9:26591256-26591278 TGATATGAACAATGAAATCCAGG - Intergenic
1052594034 9:30536229-30536251 TGATATGAACAATGAAATCCAGG + Intergenic
1053746405 9:41202220-41202242 TGAAATGAACATTTACATTCTGG - Intergenic
1054480862 9:65663002-65663024 TGAAATGAACATTTACATTCTGG + Intergenic
1054681938 9:68229058-68229080 TGAAATGAACATTTACATTCTGG + Intergenic
1055713419 9:79089693-79089715 TGATATGAACAATGAAATCCAGG - Intergenic
1056903167 9:90620158-90620180 TGAAATGTACACTTTAATGCGGG + Intronic
1056959904 9:91114019-91114041 TTAAATGAACCATTAATGCCAGG - Intergenic
1058895697 9:109398834-109398856 TTAAATGGACACTTCAACTCAGG + Intronic
1060053886 9:120396822-120396844 TAAAATGAAGATTTGAATCCAGG - Intronic
1202782537 9_KI270718v1_random:12995-13017 TGAAATGAACATTTACATTCTGG - Intergenic
1186433694 X:9525759-9525781 TTACATAAACATTTAAATTCTGG - Intronic
1186980854 X:14955931-14955953 TAATATGGACAATTAAATCCAGG - Intergenic
1187732381 X:22268860-22268882 TTAAATGAGAAATAAAATCCAGG + Intergenic
1188774038 X:34190314-34190336 TGATATGGACAATTAAATCCAGG - Intergenic
1188857097 X:35209810-35209832 TGATATGAACAATGAAATCCAGG - Intergenic
1189070561 X:37859416-37859438 TTCTATGAACACTTATATCATGG - Intronic
1190820729 X:53969140-53969162 TGAAAGGACCACTTGAATCCGGG + Intronic
1192676661 X:73203571-73203593 TGATATGAACAGTGAAATCCAGG - Intergenic
1194226980 X:91273178-91273200 TTAATTCAACAATCAAATCCAGG + Intergenic
1194229380 X:91302489-91302511 TTATATCAACACTTAAATCCTGG + Intergenic
1194303096 X:92210880-92210902 TTATATGAACAATGAAGTCCAGG - Intronic
1194431074 X:93806402-93806424 TTAAATGTATACATAAATCTAGG + Intergenic
1197508059 X:127333084-127333106 TTTATTGAGCACTTAACTCCAGG - Intergenic
1199132495 X:144208165-144208187 TGAAATGAACAATAAAATCCAGG + Intergenic
1199729498 X:150617416-150617438 TGAAATGAACAGTTAAATAAGGG - Intronic
1200342028 X:155408144-155408166 TTACATGAATAATGAAATCCAGG + Intergenic