ID: 972699248

View in Genome Browser
Species Human (GRCh38)
Location 4:41477912-41477934
Sequence CACAGCTACCACCTTAATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 101}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972699241_972699248 30 Left 972699241 4:41477859-41477881 CCAGGATTTAAGTGTTCATTTAA 0: 1
1: 0
2: 2
3: 26
4: 321
Right 972699248 4:41477912-41477934 CACAGCTACCACCTTAATGGTGG 0: 1
1: 0
2: 0
3: 12
4: 101
972699246_972699248 0 Left 972699246 4:41477889-41477911 CCATGAAGTAGGCATGTGGGGAT 0: 1
1: 0
2: 0
3: 8
4: 140
Right 972699248 4:41477912-41477934 CACAGCTACCACCTTAATGGTGG 0: 1
1: 0
2: 0
3: 12
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972699248 Original CRISPR CACAGCTACCACCTTAATGG TGG Intronic
900981766 1:6049867-6049889 CACAGCTGCCTCTTTCATGGGGG - Intronic
902555121 1:17242348-17242370 CTCAGCTACCACCTGAAATGTGG + Intronic
903366159 1:22806643-22806665 CACAGCTAACACCTGCCTGGCGG - Intronic
904931044 1:34087759-34087781 CAAAGCCACCGCCTTCATGGAGG - Intronic
907758922 1:57338420-57338442 CACAGCTACCATCTAAAATGAGG - Intronic
910151661 1:84154911-84154933 CTCAGCTAACATCTTAATAGCGG + Intronic
911721735 1:101198493-101198515 AGCAGCTACCACCATGATGGAGG - Intergenic
914464772 1:147917157-147917179 CACAACTACCAAGTTAATGCTGG + Intergenic
916931097 1:169578810-169578832 AATGGCTACCACCTTCATGGGGG - Intronic
919858290 1:201720397-201720419 CACAGCTCCCAGATTGATGGAGG + Intronic
1064771483 10:18728216-18728238 CAAAGCTACAACCTGACTGGTGG - Intergenic
1068190363 10:53643577-53643599 CACAGCTACTAGCATAATGATGG + Intergenic
1069808616 10:71142079-71142101 CCCAGGTAGCACCATAATGGAGG + Intergenic
1069886427 10:71626786-71626808 CCCAGTTACCACCTTCATGGAGG - Intronic
1075394264 10:122115238-122115260 CACAGCCCCCACCTTCAAGGAGG + Intronic
1075990162 10:126830307-126830329 CACAGCTAACATCTTACTGATGG + Intergenic
1077165155 11:1131449-1131471 CACCGCTGCCCCCTTACTGGGGG - Intergenic
1079122912 11:17697831-17697853 CACAGCTCCCACGCTAATGTGGG - Intergenic
1079347646 11:19667093-19667115 CACAGCTAGCAGCTTCCTGGGGG - Intronic
1081731737 11:45376510-45376532 CCAAGCTACCACCTTAGTGTGGG - Intergenic
1083632824 11:64104521-64104543 CACTGCTACCACCTTTAGGGAGG - Intronic
1088895091 11:114072479-114072501 CACAGATACCACCTTACTGATGG + Intronic
1094212043 12:27903113-27903135 TACAGCCACCACCTTAATACAGG + Intergenic
1096567944 12:52496736-52496758 GACAGCTCCCACCTGAAGGGAGG - Intergenic
1096788132 12:54029446-54029468 CACAGGTCCCACCTTATAGGAGG + Intronic
1100360179 12:93870572-93870594 CAGAGCTTCCACCCTACTGGTGG - Intronic
1102199632 12:111048433-111048455 CACAGCTCCCACCTTGCTGGGGG - Intronic
1104894480 12:132155095-132155117 CACAGCTACATCCGTAATGAGGG + Intergenic
1106229687 13:27812252-27812274 CACAGCTACCACCCTAGTGCAGG - Intergenic
1108276713 13:48818419-48818441 TGAAGTTACCACCTTAATGGTGG + Intergenic
1112208924 13:97353906-97353928 CAGAGCTACCACTTTAAAGTAGG - Intronic
1112414516 13:99193260-99193282 CACAGCTCCCATTTTAAAGGAGG + Intergenic
1117301010 14:54428077-54428099 CACAGCTGAAAGCTTAATGGCGG + Intronic
1118323805 14:64768517-64768539 CACAGCTCCTCCCTGAATGGTGG + Intronic
1121773077 14:96569194-96569216 CACATTTCCCACCTTACTGGTGG - Intergenic
1125718399 15:41832944-41832966 CAAAGGTACCACCTGAATAGAGG + Intronic
1126961045 15:53994876-53994898 CAGAGCTACCACCTTAGTTCAGG - Intergenic
1130792411 15:87169606-87169628 GACAGGTTCTACCTTAATGGAGG + Intergenic
1133737039 16:8623769-8623791 CACAGCAACCACTTAAATGTAGG + Intronic
1135964771 16:27026739-27026761 CACAGCTCCCAACTTCATGAAGG + Intergenic
1141825703 16:86478329-86478351 CACAGCTGCCACCAAGATGGAGG + Intergenic
1142948199 17:3453529-3453551 CACAGCTAACATCATAATGGGGG + Intronic
1143996826 17:11013674-11013696 CACAGCTGCCACATTAAAGAAGG + Intergenic
1149663112 17:58346372-58346394 CTCAGCTGCCACCTTGAGGGGGG + Intronic
1154018089 18:10637964-10637986 CACAGCCACCACCTGCATCGAGG - Intergenic
1154186780 18:12191618-12191640 CACAGCCACCACCTGCATCGAGG + Intergenic
1160560331 18:79751998-79752020 CTCAGCTACAACCTTAGAGGTGG - Intronic
1164061937 19:21683210-21683232 TACACCTTCCTCCTTAATGGAGG - Intergenic
926854140 2:17233951-17233973 TACAGCTACAACCCTGATGGTGG - Intergenic
932101765 2:68907915-68907937 CACAGCTACTTTCTTAATGTAGG - Intergenic
933131221 2:78676391-78676413 AACATCCACCTCCTTAATGGAGG + Intergenic
935140774 2:100350990-100351012 CACAGTTACCACCTACATGGAGG + Intergenic
936025915 2:109031218-109031240 CACTGCTGACACCTTGATGGTGG - Intergenic
940184332 2:150966463-150966485 TACAGCTACTTACTTAATGGGGG - Intergenic
942941700 2:181626408-181626430 CAGAGCCACCATCTCAATGGCGG - Intronic
943799931 2:192045155-192045177 TACAGCTACCACCTGAAAGTGGG + Intronic
946366386 2:219251757-219251779 CACAGCTACCACCCTGGGGGAGG - Intronic
1169475521 20:5928015-5928037 CACAGTTGGCAGCTTAATGGTGG + Intergenic
1172014331 20:31863925-31863947 CACTGCTGCCGCCTTAATGGGGG - Exonic
1172484286 20:35288947-35288969 CACAGCCACCACCTGGGTGGGGG + Exonic
1177003991 21:15648268-15648290 TACAGCTACTACCTCTATGGAGG + Intergenic
1179182690 21:39059154-39059176 CACATCCACCAGCTGAATGGAGG + Intergenic
1180939762 22:19651908-19651930 CACAGCTAACATCATAATGGTGG + Intergenic
1182034123 22:27184110-27184132 GACAGATTCCACCTTGATGGTGG - Intergenic
1184579022 22:45400173-45400195 CACACCTACCACCTAGATGTTGG + Intronic
1184864869 22:47196458-47196480 CTCAGGTTCTACCTTAATGGAGG - Intergenic
953420541 3:42750308-42750330 TCCAGCTGCAACCTTAATGGAGG + Intronic
956761592 3:72448605-72448627 CACAGCTGCCTCCTTAGGGGAGG + Intergenic
967863372 3:194170242-194170264 CACCACTCCCACCTTCATGGTGG + Intergenic
972699248 4:41477912-41477934 CACAGCTACCACCTTAATGGTGG + Intronic
976064154 4:81164620-81164642 CACACCTAACACTCTAATGGTGG - Intronic
977727274 4:100311086-100311108 GGCAGCTAGCACCTTAAGGGTGG + Intergenic
989552563 5:42752785-42752807 CACAGCTAACATTTTGATGGAGG + Intergenic
991657005 5:68914073-68914095 CACAGCAACCACCTTGCTTGAGG + Intergenic
995905993 5:117123802-117123824 CAAAGTTACCACCATAGTGGAGG - Intergenic
999756513 5:154668609-154668631 CTCTGCTACCACCTTAATTTTGG - Intergenic
1000116731 5:158160765-158160787 CACAGCAACCACATTAGAGGCGG + Intergenic
1000293293 5:159891063-159891085 CATAGCTACCATCTTAGAGGGGG - Intergenic
1003755872 6:9119230-9119252 CACAGCTACCACGTTTCTGAAGG + Intergenic
1004430469 6:15538140-15538162 CACAGCTGACTCCTTAAAGGGGG + Intronic
1005776061 6:29131710-29131732 GTCAGCTAACACCTTTATGGGGG - Intergenic
1009359150 6:62792476-62792498 AACAAGTACCACTTTAATGGGGG + Intergenic
1011984715 6:93428897-93428919 CACAGCTACCACCTTTCTTTTGG - Intergenic
1012987457 6:105890101-105890123 CACACCTACCACCTAGATAGTGG + Intergenic
1013617864 6:111861406-111861428 CACAACTACCACCTTAAATGTGG - Intronic
1013664698 6:112335500-112335522 CACAGCAGCCTCCTAAATGGTGG - Intergenic
1016227579 6:141758984-141759006 TACAGCTAACATCTTAATAGTGG + Intergenic
1018520225 6:164641131-164641153 CACAGCTACCACCCCCATGCTGG + Intergenic
1022772666 7:33491294-33491316 CAAAGCTACCACATTAAATGTGG + Intronic
1028329265 7:89568479-89568501 CACAGCCAGCATCTTAATGAAGG + Intergenic
1029107443 7:98189829-98189851 CACAGCTGCCAGCGTGATGGGGG + Intronic
1029272961 7:99387930-99387952 TACAGCTTCCACCTGGATGGTGG + Intronic
1035656527 8:1311433-1311455 CTCAGCTACCACGGTAATGCTGG - Intergenic
1037002548 8:13737539-13737561 CACTAGTACCACCTTATTGGTGG - Intergenic
1039455336 8:37702240-37702262 CAAAGTTGCCATCTTAATGGAGG + Intergenic
1043649926 8:82578674-82578696 CACAGCTGCCACTCTATTGGAGG - Intergenic
1046594545 8:116246383-116246405 CAAACATACCACCTTGATGGGGG + Intergenic
1046846150 8:118919000-118919022 CACACCTAGCACCTTGATTGTGG + Intergenic
1053559320 9:39173739-39173761 CAGAGATACCAGCTTAATTGTGG + Intronic
1054137791 9:61445207-61445229 CAGAGATACCAGCTTAATTGTGG - Intergenic
1057480184 9:95439206-95439228 CACAGCTTCCACTTACATGGCGG - Intergenic
1058312615 9:103523770-103523792 AACACCTACCACCTTACAGGGGG + Intergenic
1058481297 9:105398102-105398124 CACAGCTACTGCCTAAATGATGG - Intronic
1060009068 9:120027419-120027441 CAGAGCTACCTCCTTGATGGGGG - Intergenic
1061765794 9:132880458-132880480 CACAGCTCCCACCATGATGAGGG + Intronic
1187037332 X:15554820-15554842 ATGAGATACCACCTTAATGGTGG + Intronic
1187102030 X:16203042-16203064 CACAGCTTCCAACTAAATAGAGG - Intergenic
1188023405 X:25183649-25183671 CACAGCTAGCACTTCAATGTGGG - Intergenic
1188260049 X:28012370-28012392 CACTTCTTCCACCTTAATGGTGG - Intergenic
1189281097 X:39820705-39820727 CACAGGTACCACCTGGGTGGTGG - Intergenic
1189689897 X:43605081-43605103 CACAGCTGACACCTTGATTGAGG + Intergenic
1193898830 X:87149916-87149938 CCCAGCTTCCACCTTCATGTAGG + Intergenic
1201235543 Y:11907535-11907557 CACAGCTAACACCTTACTTTGGG + Intergenic
1201621419 Y:15962869-15962891 CACATCTCCCTCCTGAATGGTGG - Intergenic