ID: 972699758

View in Genome Browser
Species Human (GRCh38)
Location 4:41482735-41482757
Sequence CTGCTCCATTGTAAGAGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 133}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972699758_972699761 -8 Left 972699758 4:41482735-41482757 CCTGAGCTCTTACAATGGAGCAG 0: 1
1: 0
2: 1
3: 18
4: 133
Right 972699761 4:41482750-41482772 TGGAGCAGGTAATATAATCTGGG 0: 1
1: 0
2: 0
3: 27
4: 248
972699758_972699760 -9 Left 972699758 4:41482735-41482757 CCTGAGCTCTTACAATGGAGCAG 0: 1
1: 0
2: 1
3: 18
4: 133
Right 972699760 4:41482749-41482771 ATGGAGCAGGTAATATAATCTGG 0: 1
1: 0
2: 0
3: 12
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972699758 Original CRISPR CTGCTCCATTGTAAGAGCTC AGG (reversed) Intronic
901150421 1:7097512-7097534 CAGCCCCATTGTAAGACCCCTGG + Intronic
903226891 1:21898899-21898921 CTGCTCCCTGGGAAAAGCTCTGG - Intronic
904395611 1:30219449-30219471 ATGGTCCATTGTAAGGACTCTGG + Intergenic
905244322 1:36602254-36602276 ATGCTCCTTTGTCAGAGCTGTGG + Intergenic
911404758 1:97422665-97422687 CTGGTCCATAGTAGGTGCTCAGG - Intronic
912051672 1:105537036-105537058 CTGCTCCATAGTTAGAGTTAAGG + Intergenic
915015327 1:152727797-152727819 CTGCTCCATTATAATAGGTGAGG + Intergenic
918736225 1:188066865-188066887 CTGCTACATTGGAGGAGCTGAGG + Intergenic
919776814 1:201199594-201199616 CTGCTCCTTTTTCAGACCTCAGG + Exonic
920048679 1:203150295-203150317 CTGCTCCACTGCATGTGCTCAGG - Intronic
920277361 1:204816581-204816603 CTGTTCCATTGATAGAGCACAGG - Intergenic
920724141 1:208417812-208417834 CTGCTCCATTGCAAGAAGTCAGG + Intergenic
921210482 1:212892432-212892454 TTGTTCCATTGTTAGAGCTTAGG - Intronic
924168690 1:241313475-241313497 TTGCTCCATTGATAGAGCACAGG - Intronic
1062932216 10:1360869-1360891 TTTCTCCATCGTGAGAGCTCAGG + Intronic
1064246024 10:13668328-13668350 CAGGGCCATTGTAACAGCTCAGG - Intronic
1066500652 10:35991302-35991324 CTGGGCAATTGTAAGAGCCCTGG + Intergenic
1066628544 10:37435550-37435572 CTGGGCAATTGTAAGAGCCCTGG + Intergenic
1067053452 10:43038296-43038318 CTGCTCCAATGAAACAGCTGTGG + Intergenic
1068341093 10:55704156-55704178 CTGCTACTTTGGAAGAGCTCTGG - Intergenic
1069996250 10:72343793-72343815 CTTCCCCATGGGAAGAGCTCAGG + Intronic
1071688770 10:87792901-87792923 CTTCTCCATTGTGAGCCCTCAGG + Intronic
1073513637 10:104058212-104058234 CTCCTCCAGTTTAAAAGCTCAGG - Intronic
1074232659 10:111553311-111553333 CTGCTTCATTGTCAGGGCCCAGG + Intergenic
1076356678 10:129858386-129858408 CTGTTCCATCGTAAGAGCCCTGG + Intronic
1077506960 11:2934070-2934092 AGGCTCCAGTGGAAGAGCTCAGG - Intergenic
1080253077 11:30257805-30257827 CTGCTCCATAGGCAGAGCACGGG - Intergenic
1081806170 11:45891977-45891999 CTGATACATTGCAAGAACTCTGG - Intronic
1086619977 11:88875896-88875918 CTGTTCCATTTTTAGAGCACAGG + Intronic
1087842904 11:102938316-102938338 CTGCCCCATTGAAAGATTTCAGG + Intergenic
1089146363 11:116332212-116332234 CTGATGCAGTGGAAGAGCTCTGG - Intergenic
1091049024 11:132351331-132351353 CTACTACATTGCAATAGCTCAGG + Intergenic
1096784052 12:54007092-54007114 CTGCTCCAATGCCAGAGTTCTGG + Intronic
1097974977 12:65675685-65675707 CTTTTCCATTGTAAGATCACTGG - Intergenic
1099633029 12:85174953-85174975 CTGACCCATTGCAAGAGATCTGG - Intronic
1101792165 12:107937523-107937545 CTGCTCCAGAGTGAGGGCTCTGG + Intergenic
1102018964 12:109668443-109668465 CTGCCTCCTTGTAAGAACTCTGG - Intergenic
1103183978 12:118940208-118940230 CTGGCCCATAGTAACAGCTCAGG - Intergenic
1103961934 12:124614322-124614344 CTGCTCCATTGGGAGCACTCAGG + Intergenic
1106582016 13:31026982-31027004 CTGGTGCATTGTAGGTGCTCAGG + Intergenic
1106940668 13:34775423-34775445 CTGCTCAATATTAGGAGCTCAGG - Intergenic
1113132786 13:107056808-107056830 CTGCTTCATTATCAGTGCTCAGG + Intergenic
1117896716 14:60495121-60495143 CTGTTCCAATGTAAGATCTATGG - Intronic
1121578358 14:95007220-95007242 CAGCTCAATTGAAACAGCTCTGG + Intergenic
1122589609 14:102838240-102838262 CAGCACCATTGTAAGTGCTGAGG + Intronic
1124232567 15:27957885-27957907 GGGCTCCATTGCAATAGCTCAGG - Intronic
1128914225 15:71545278-71545300 CTGCTCTACTGCAAGGGCTCTGG - Intronic
1133721093 16:8495108-8495130 CTGTTCCATTCTAAGTGCTGCGG + Intergenic
1135882005 16:26266912-26266934 GTGCTCCATTGAAAGGGCACGGG - Intergenic
1143266167 17:5639613-5639635 CTGCTCCAGTGTCTGAGCTGGGG + Intergenic
1143643010 17:8210336-8210358 CTGCTCCCTTTTACCAGCTCGGG - Intronic
1145277764 17:21444976-21444998 CTGCTCCATCGAAAAATCTCCGG - Intergenic
1145306235 17:21676813-21676835 CTCCTCCTTTGAAAGAGCACTGG + Intergenic
1145714032 17:27002794-27002816 CTGCTCCATCGAAAAATCTCCGG - Intergenic
1146035598 17:29403787-29403809 CTGCTTCGGTGTAAGAGGTCAGG - Intronic
1146664412 17:34687947-34687969 CTGCTGCATTGTAGGTGCTCAGG - Intergenic
1149345547 17:55731453-55731475 GTGCTCTATTGTCAGATCTCAGG + Intronic
1149696228 17:58618359-58618381 CTGCTGCATTTTATGACCTCAGG - Intronic
1150103448 17:62444114-62444136 CCCCTACATTGAAAGAGCTCAGG + Intronic
1153987458 18:10366116-10366138 CTGCACGATTGGAAGAGCTCGGG - Intergenic
1154267415 18:12891158-12891180 CTGCTCCCTTGGAAGGGTTCAGG - Intronic
1155394826 18:25376499-25376521 CTACTCCATTGTAAAACTTCTGG + Intergenic
1155695774 18:28684445-28684467 CTGCTGAATTGCAGGAGCTCAGG - Intergenic
1158057062 18:53294000-53294022 CCGCTTCATTGTAGGAGCACAGG - Intronic
1162846760 19:13398795-13398817 CTGATGCATAGTAAGTGCTCAGG + Intronic
1166864553 19:45827979-45828001 CTGCTGAATTGTAGGAGCTCAGG + Intronic
925516802 2:4692051-4692073 CTGCTTTATTCTAACAGCTCTGG - Intergenic
926757924 2:16250844-16250866 TTGCTGCTTTGCAAGAGCTCGGG - Intergenic
929172862 2:38948938-38948960 CTGTTCCATTGTAAGCGCTCAGG + Intronic
932428713 2:71660291-71660313 CTGCTCCATTGGGAGAGGCCAGG - Intronic
933292558 2:80453974-80453996 CTGCACAATTGTCAAAGCTCTGG + Intronic
933774854 2:85765758-85765780 CTGCTCCATTCAAAGAACCCGGG - Intronic
938759382 2:134410306-134410328 CTGCTCCATTGTAATATCACAGG + Intronic
947269559 2:228318718-228318740 CTGCTCCATTCCCAGAGATCTGG - Intergenic
947580028 2:231309874-231309896 CTGCTTGGTTTTAAGAGCTCAGG + Intronic
948273507 2:236691505-236691527 CTGTTCCATTATAAGAACACTGG - Intergenic
1169322284 20:4643433-4643455 CTGTTCCATTTTTAGAGCACAGG - Intergenic
1169604969 20:7306988-7307010 CTGCTCCATTGTACTAGCTTAGG - Intergenic
1171412562 20:24956942-24956964 TTGCTCCATTTTCAGAGCTGAGG - Intronic
1171531478 20:25856274-25856296 CTTCTCCTTTGAAAGAGCACTGG + Intronic
1171543964 20:25986879-25986901 CTCCTCCATTGAAAGAGCAGTGG - Intergenic
1174066833 20:47871796-47871818 TGACTCCATTGTAAGAGCACAGG - Intergenic
1174757930 20:53177945-53177967 CTGGTGCATTGTAAGCACTCTGG + Intronic
1177564139 21:22796347-22796369 ATGCACCAGTGTAAGAGCACAGG - Intergenic
1178186215 21:30224317-30224339 CTGGTTCATAGTAAGAGCTCAGG + Intergenic
1179391366 21:40994966-40994988 CTGCTGTCTTGTTAGAGCTCTGG - Intergenic
955397592 3:58568131-58568153 CTTGTCCATTGTAAGAGATCTGG + Intronic
955782779 3:62503895-62503917 CTGCTCCTTTCTAATAGTTCTGG + Intronic
956742579 3:72286764-72286786 CTGCTCCCTTCTAAAAGCCCAGG + Intergenic
960953270 3:123013280-123013302 CTGCTACAGTGTAAGCTCTCAGG + Intronic
961636163 3:128334440-128334462 CTGCTCGACTGTCAGAGCTGAGG + Intronic
962728309 3:138256049-138256071 CTGCTCCAATGTAAGATGTTTGG - Intronic
964661771 3:159127452-159127474 CTGGTACAAAGTAAGAGCTCAGG + Intronic
965266837 3:166554260-166554282 CTGCTCTATTTCAAGGGCTCTGG - Intergenic
965945432 3:174234554-174234576 CAGCTTCATGGTAAGATCTCAGG - Intronic
966472229 3:180303635-180303657 CTGCTGATGTGTAAGAGCTCTGG - Intergenic
966843258 3:184106253-184106275 CTGCTCCACTGCAACAGCCCGGG + Exonic
968151125 3:196337480-196337502 CAGCTTCCTGGTAAGAGCTCAGG + Intronic
969099411 4:4757528-4757550 ATGCCCCATTGTAAGAGCTGGGG - Intergenic
972162305 4:36242266-36242288 ATGCTACATTGTAAGAGTTTTGG - Intronic
972609331 4:40642336-40642358 CTGGTCCATTGTAAGGACTTTGG + Intergenic
972699758 4:41482735-41482757 CTGCTCCATTGTAAGAGCTCAGG - Intronic
973649855 4:52987854-52987876 CTGATCCACTGTAATAGCTAGGG + Intronic
977696595 4:99972363-99972385 CTGCTGCACTGTAGGAGCTGAGG - Intergenic
978109091 4:104940821-104940843 GTGCTCCAGTGGAAGAGCTCTGG - Intergenic
981617522 4:146656989-146657011 CTGCTCCATTATAAAAGAACTGG + Intergenic
986806515 5:11312990-11313012 CTGCTCCAATGGATGTGCTCAGG - Intronic
987132382 5:14871758-14871780 CGGCTCCATTATAAGCGCTCTGG + Exonic
987430864 5:17831489-17831511 CACCTCCTTTGTAAGGGCTCAGG + Intergenic
996749571 5:126875206-126875228 CAGCTCCACCCTAAGAGCTCAGG - Intronic
998270018 5:140697974-140697996 CTGCACTATTGTGAGAGCACAGG + Exonic
998349318 5:141490710-141490732 CTACTCCATTGTAGGAAATCAGG + Exonic
1000625747 5:163536300-163536322 CTGCTCCATTATTTTAGCTCTGG + Intergenic
1000743425 5:164998750-164998772 CAGCTCCATTGTTAGAGACCTGG + Intergenic
1003920146 6:10825269-10825291 TTGAGCCATTGAAAGAGCTCTGG + Intronic
1005734049 6:28728914-28728936 TAGCTCAATTGGAAGAGCTCTGG + Intergenic
1006897577 6:37480745-37480767 CTGCTGGACTGTCAGAGCTCTGG - Exonic
1019784329 7:2965234-2965256 CTGCCCCAGTGCAAAAGCTCTGG + Intronic
1022286398 7:28958538-28958560 CGGCTCCAGTGCAATAGCTCGGG + Intergenic
1023734473 7:43222790-43222812 CGGCCCAATGGTAAGAGCTCAGG - Intronic
1025284180 7:57649217-57649239 CTCCTCCTTTGAAAGAGCACTGG + Intergenic
1025295344 7:57771958-57771980 CTCCTCCATTGAAAGAGCAGTGG - Intergenic
1026772908 7:73213438-73213460 CTGCTCCACTGTCAGAGCCCCGG + Intergenic
1027013771 7:74766834-74766856 CTGCTCCACTGTCAGAGCCCCGG + Intergenic
1027074267 7:75179198-75179220 CTGCTCCACTGTCAGAGCCCCGG - Intergenic
1028178242 7:87682708-87682730 TTGCTCCATTTATAGAGCTCAGG + Intronic
1029474297 7:100773844-100773866 CTGCTCCATTGTCGGGCCTCAGG + Exonic
1032032634 7:128497317-128497339 CCCCTACATTGAAAGAGCTCAGG + Intronic
1032296685 7:130645341-130645363 CTACTACATTGTTAGATCTCAGG + Intronic
1033295592 7:140131291-140131313 ATGCCCCATTGGAAGAGATCTGG - Intronic
1033635028 7:143204361-143204383 CTCCTCTATTCTAAGTGCTCAGG + Intergenic
1033803084 7:144923810-144923832 CTGATCCATTCTCAGTGCTCAGG - Intergenic
1034265365 7:149778036-149778058 CTGCTCCACGGTGAGAGCACTGG + Intergenic
1036617166 8:10397314-10397336 CTGGTACTTTGTAGGAGCTCAGG + Intronic
1037595232 8:20349238-20349260 CTGCTCAATTCTCAGAGTTCAGG + Intergenic
1039344060 8:36684517-36684539 TTGTTCCAATGTAAGATCTCAGG + Intergenic
1039963838 8:42269873-42269895 CTGCTTCATTGTAATAGCAGGGG - Intergenic
1041168870 8:55120037-55120059 ATGCACCATTGTAAAAGTTCAGG - Intronic
1044834455 8:96281947-96281969 CTGGTGCATAGTAAGTGCTCAGG + Intronic
1046580230 8:116083219-116083241 ATGCTCCATTTTAAGAATTCTGG - Intergenic
1047110153 8:121781158-121781180 GTGCTGCATTGTAGGAGCTTTGG - Intergenic
1053034541 9:34813181-34813203 CTGCTCCATAGCATGAGCTAAGG - Intergenic
1059391736 9:114003467-114003489 CTTCTCCATTCAATGAGCTCTGG - Intronic
1060211288 9:121712077-121712099 CGGCTCCCCTGGAAGAGCTCCGG - Intronic
1062685076 9:137808327-137808349 CTGCGCCATGGTTGGAGCTCTGG + Intronic
1187977660 X:24719564-24719586 CTGCCCCATTGTACAACCTCAGG + Intronic
1188519951 X:31027439-31027461 CTGCTTTATTATAAGAACTCTGG + Intergenic
1188751628 X:33912095-33912117 CCTTTCCATTGTTAGAGCTCTGG - Intergenic
1192222999 X:69210136-69210158 CTGCTCAATTGTCACAGCCCAGG - Intergenic
1193976550 X:88127179-88127201 CTGCACCGTTGTAAGAGCTATGG - Intergenic
1194846435 X:98815055-98815077 TTGCTCCATTTTCAGAGCACAGG + Intergenic
1198522380 X:137466002-137466024 CAGCTCCATTGAAAGAGCTAAGG + Intergenic
1198880695 X:141277888-141277910 CTGTTGCATTGTCAGAGGTCAGG - Intergenic