ID: 972700143

View in Genome Browser
Species Human (GRCh38)
Location 4:41486353-41486375
Sequence ATCCAGGTGGCACAGTAATA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 103}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972700138_972700143 17 Left 972700138 4:41486313-41486335 CCTTGTCTGGAAAGTTACTGAGA 0: 1
1: 0
2: 1
3: 7
4: 201
Right 972700143 4:41486353-41486375 ATCCAGGTGGCACAGTAATAAGG 0: 1
1: 0
2: 1
3: 11
4: 103
972700136_972700143 24 Left 972700136 4:41486306-41486328 CCCAGTGCCTTGTCTGGAAAGTT No data
Right 972700143 4:41486353-41486375 ATCCAGGTGGCACAGTAATAAGG 0: 1
1: 0
2: 1
3: 11
4: 103
972700141_972700143 -8 Left 972700141 4:41486338-41486360 CCTTCGTCAGTCAGGATCCAGGT 0: 1
1: 0
2: 0
3: 4
4: 84
Right 972700143 4:41486353-41486375 ATCCAGGTGGCACAGTAATAAGG 0: 1
1: 0
2: 1
3: 11
4: 103
972700137_972700143 23 Left 972700137 4:41486307-41486329 CCAGTGCCTTGTCTGGAAAGTTA No data
Right 972700143 4:41486353-41486375 ATCCAGGTGGCACAGTAATAAGG 0: 1
1: 0
2: 1
3: 11
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972700143 Original CRISPR ATCCAGGTGGCACAGTAATA AGG Intronic