ID: 972701268

View in Genome Browser
Species Human (GRCh38)
Location 4:41496371-41496393
Sequence TGCTAGCTAGAGTCCCACTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 2, 3: 3, 4: 83}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972701268_972701277 29 Left 972701268 4:41496371-41496393 CCCCAGTGGGACTCTAGCTAGCA 0: 1
1: 0
2: 2
3: 3
4: 83
Right 972701277 4:41496423-41496445 TGAACCACATAGGAGGCCAGAGG 0: 1
1: 0
2: 2
3: 15
4: 167
972701268_972701274 4 Left 972701268 4:41496371-41496393 CCCCAGTGGGACTCTAGCTAGCA 0: 1
1: 0
2: 2
3: 3
4: 83
Right 972701274 4:41496398-41496420 CAGCAAAGAGTTTGCTAAAGTGG No data
972701268_972701275 19 Left 972701268 4:41496371-41496393 CCCCAGTGGGACTCTAGCTAGCA 0: 1
1: 0
2: 2
3: 3
4: 83
Right 972701275 4:41496413-41496435 TAAAGTGGAATGAACCACATAGG 0: 1
1: 1
2: 0
3: 16
4: 196
972701268_972701276 22 Left 972701268 4:41496371-41496393 CCCCAGTGGGACTCTAGCTAGCA 0: 1
1: 0
2: 2
3: 3
4: 83
Right 972701276 4:41496416-41496438 AGTGGAATGAACCACATAGGAGG 0: 1
1: 0
2: 1
3: 7
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972701268 Original CRISPR TGCTAGCTAGAGTCCCACTG GGG (reversed) Intronic
902268911 1:15289219-15289241 AGCTAGCTAGCCTCCCACTTTGG + Intronic
906569109 1:46821029-46821051 TGCTAACTTGATTCCCAATGTGG + Intergenic
910500271 1:87882509-87882531 TCCCAGCTAGGGCCCCACTGTGG + Intergenic
912711717 1:111954602-111954624 TGCCAGCCAGAATCCCACTCTGG - Intronic
1063076105 10:2718423-2718445 TCCCAGCTAGAGCCCCACTAGGG + Intergenic
1070646036 10:78203174-78203196 GGCTCCCTAGAGGCCCACTGTGG - Intergenic
1072239820 10:93485342-93485364 TGCTGGCAAGAGTACCATTGTGG - Intergenic
1074756023 10:116624755-116624777 TGTCAGATAGAGTCCCACAGTGG - Intronic
1075607185 10:123820444-123820466 TGCTCACTAGTGTCCCACTTTGG + Intronic
1089829458 11:121313644-121313666 TGTGAGGTAGTGTCCCACTGTGG + Intergenic
1093487734 12:19670097-19670119 TGCTAGGTAGAGCTCCAGTGGGG + Intronic
1098713702 12:73801560-73801582 TACTAGGCAGTGTCCCACTGGGG - Intergenic
1100560698 12:95746670-95746692 TGCAAGGTAGAGTTCCACAGAGG - Intronic
1101565682 12:105902735-105902757 TGCTAGATAGAGGCCCATGGGGG + Intergenic
1104093875 12:125538436-125538458 TGCTTGCTAGAGTGCCACTGAGG - Intronic
1105755234 13:23457710-23457732 AGCTATCCAGGGTCCCACTGTGG + Intergenic
1106757870 13:32840392-32840414 TGCTAGGGATAGTCACACTGTGG + Intergenic
1122063825 14:99158010-99158032 TGCTATCTAGAGTCTCCTTGGGG - Intergenic
1122195645 14:100083002-100083024 TGCTTTCTAGAGTCCCTGTGTGG - Intronic
1122505583 14:102229824-102229846 TGCCCACTAGAGTCCCACGGGGG + Intronic
1124487485 15:30132184-30132206 TGCTAACTGGAATCCCAGTGGGG + Intergenic
1124542574 15:30601160-30601182 TGCTAACTGGAATCCCAGTGGGG + Intergenic
1124756044 15:32406139-32406161 TGCTAACTGGAATCCCAGTGGGG - Intergenic
1128576083 15:68776041-68776063 TGCTTATTAGAGACCCACTGTGG + Intergenic
1129910038 15:79219533-79219555 GGCCAGCTGGAGTCACACTGGGG - Intergenic
1140944740 16:79757427-79757449 TGCTCGGTAGTGACCCACTGTGG - Intergenic
1143517129 17:7425535-7425557 AGCTAGCGAGAGTCACAATGTGG - Intergenic
1143804812 17:9417612-9417634 AGCTATCTAGGGCCCCACTGAGG - Intronic
1146314742 17:31798102-31798124 GGCTAACTAGAGTCTCATTGGGG + Intergenic
1150600125 17:66643808-66643830 TCCTAGATAGAGTTCCACTTGGG + Intronic
1151450766 17:74196948-74196970 TGCTAGGCAGAGTCCCCCAGGGG - Intergenic
1152483028 17:80568714-80568736 TGCTAGATATTGTCCCACTGAGG + Intronic
1155577115 18:27259868-27259890 TGCTAGCTAGAGTCCCCAGTTGG + Intergenic
1159070141 18:63613773-63613795 TGCTATCTTGACTCCCAGTGGGG + Intergenic
1160624660 18:80195022-80195044 TGCCAGCCAGAGTCCCACCTTGG + Intronic
1162471247 19:10872871-10872893 AGCTAGCTAGAGGCCTCCTGAGG - Intronic
1165385461 19:35507938-35507960 TGCTAGCTGGAGAGCCAGTGGGG + Intronic
925473785 2:4190733-4190755 TGCTAGATAGAGTAGCGCTGTGG + Intergenic
942872257 2:180749352-180749374 TTCTAGCTAGGTTCCCACTAAGG + Intergenic
946051115 2:216863363-216863385 TGCTAGCTTGAGCAACACTGGGG - Intergenic
946428788 2:219613746-219613768 AGCTAGCTGGAGGCTCACTGTGG - Exonic
948890622 2:240905423-240905445 TGCTGGCAGGAGTCCCTCTGGGG - Intergenic
948948317 2:241233116-241233138 GGCTTGCTAGTCTCCCACTGTGG + Intronic
1168844692 20:935873-935895 TGTTAGGAAGAGACCCACTGGGG - Intergenic
1175106890 20:56621848-56621870 TGCTGGCTAGAGTTCCCCTCTGG + Intergenic
1182813531 22:33137969-33137991 TACTAGATGGAGCCCCACTGGGG - Intergenic
1184389762 22:44196549-44196571 TGCCAGCAACAGTCCCACCGGGG - Intronic
949211584 3:1509461-1509483 TGCTAGCTAGAGTTTCAATAGGG + Intergenic
949870214 3:8581946-8581968 TGCTAGCCAGAGTTTGACTGTGG + Intergenic
952204705 3:31169327-31169349 GGCCAGCTAGAGTGCCACTTTGG - Intergenic
953734800 3:45483772-45483794 TGCTGGCTGGAGACCCATTGGGG + Intronic
953996290 3:47522558-47522580 TGCAAGCCAGAGTCCTACAGTGG + Intergenic
954283284 3:49600044-49600066 TGCTTGCTTGCCTCCCACTGAGG - Intronic
956560316 3:70567613-70567635 TGGAAGCTAGCTTCCCACTGTGG + Intergenic
956846134 3:73184677-73184699 TGCGAGCTAGTATCTCACTGTGG + Intergenic
961615887 3:128180747-128180769 TGCGAGCTAGTGTGCCATTGAGG + Intronic
962364235 3:134766942-134766964 TGACAGAGAGAGTCCCACTGAGG - Intronic
966512154 3:180776312-180776334 TGCTAGCCAGTGCCCCAGTGGGG + Intronic
972701268 4:41496371-41496393 TGCTAGCTAGAGTCCCACTGGGG - Intronic
976732403 4:88277299-88277321 TGCTAGCTAGAGTAACAGTGAGG - Intronic
977132462 4:93258970-93258992 TGCTGACTAGAGTACCACTGAGG + Intronic
978380906 4:108127579-108127601 TACTAGCAGTAGTCCCACTGAGG - Intronic
979093626 4:116517999-116518021 CCCTACATAGAGTCCCACTGGGG - Intergenic
980832601 4:138150066-138150088 TGCTCCCCAAAGTCCCACTGGGG + Intergenic
983653945 4:170061853-170061875 TGCTAGCTAGTGTTACTCTGAGG + Intronic
986780674 5:11062627-11062649 TCATAGCTATAGTTCCACTGGGG + Intronic
991573389 5:68078525-68078547 TGATTGTTTGAGTCCCACTGAGG - Intergenic
992945232 5:81803221-81803243 ATCTACCTGGAGTCCCACTGTGG + Intergenic
994351902 5:98755863-98755885 TGCTACTTAGAGTTCCACAGAGG + Intergenic
999734917 5:154505943-154505965 TGCTGCCTTGAGACCCACTGAGG + Intergenic
1006817371 6:36861454-36861476 TGCTCGCTCAAGTCCCGCTGTGG + Intronic
1007071681 6:39042691-39042713 TTCTGGCTAGAGTCCCCATGTGG + Intergenic
1011849102 6:91603733-91603755 TGCTAGCCAGTGCCCCAGTGAGG + Intergenic
1012342364 6:98142974-98142996 CACTAGGCAGAGTCCCACTGGGG + Intergenic
1022535670 7:31096719-31096741 TGCTAGCTGGGGTGCCAGTGTGG + Intronic
1026902889 7:74046717-74046739 CGCAACCTGGAGTCCCACTGGGG + Exonic
1026916268 7:74121808-74121830 TGCTACCTAGACACCCCCTGGGG - Exonic
1028867041 7:95725450-95725472 TGCTAGCAGCAGTCCAACTGAGG - Intergenic
1030813809 7:114008897-114008919 TGTCAGCTAGAGTTCAACTGGGG - Intronic
1042938646 8:74085948-74085970 TGTTAACTAGAGTCACCCTGCGG + Intergenic
1061661760 9:132134982-132135004 TGCAAGCTAGAGACCCAGGGAGG - Intergenic
1061733634 9:132636842-132636864 TGCTTGCTCCAGTCCCACTTAGG + Intronic
1061928746 9:133821299-133821321 TGCCAACAAGAGACCCACTGCGG - Intronic
1062145230 9:134985483-134985505 TTCTATCCAGAGTCACACTGTGG + Intergenic
1062200684 9:135301183-135301205 TGCCAGCTAGAGTCCCCCTGTGG + Intergenic
1187482495 X:19670710-19670732 TGCCAGCTAGGATCCCACAGAGG - Intronic
1190886961 X:54538940-54538962 TCCTAGCTAGGTTCCCAGTGTGG + Intronic
1197243101 X:124140706-124140728 TGATAGATAAAGTCCCAATGTGG - Intronic
1199692600 X:150320043-150320065 TGCTACCAAGAGCCTCACTGTGG + Intergenic