ID: 972701585

View in Genome Browser
Species Human (GRCh38)
Location 4:41499326-41499348
Sequence TCTTACATTCAAATGGTTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 5, 3: 25, 4: 267}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972701585_972701590 19 Left 972701585 4:41499326-41499348 CCCTGAACCATTTGAATGTAAGA 0: 1
1: 0
2: 5
3: 25
4: 267
Right 972701590 4:41499368-41499390 GACTCCTAAATGTTGCAGGGTGG 0: 1
1: 0
2: 1
3: 9
4: 156
972701585_972701588 15 Left 972701585 4:41499326-41499348 CCCTGAACCATTTGAATGTAAGA 0: 1
1: 0
2: 5
3: 25
4: 267
Right 972701588 4:41499364-41499386 ACTTGACTCCTAAATGTTGCAGG No data
972701585_972701589 16 Left 972701585 4:41499326-41499348 CCCTGAACCATTTGAATGTAAGA 0: 1
1: 0
2: 5
3: 25
4: 267
Right 972701589 4:41499365-41499387 CTTGACTCCTAAATGTTGCAGGG 0: 1
1: 0
2: 0
3: 15
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972701585 Original CRISPR TCTTACATTCAAATGGTTCA GGG (reversed) Intronic
902946374 1:19843091-19843113 ACTTATTCTCAAATGGTTCAGGG + Intergenic
903638383 1:24837252-24837274 TCTTACATTAAAATGATTTTTGG + Intronic
904867730 1:33594924-33594946 ACTTACTTGCAAACGGTTCATGG - Intronic
907709278 1:56863702-56863724 CTTGACATTCAAATGGCTCAGGG - Intronic
907925708 1:58953529-58953551 TCTTCCATGCACATGGTGCAAGG - Intergenic
908318483 1:62958421-62958443 ACAACCATTCAAATGGTTCAGGG - Intergenic
908570144 1:65401170-65401192 TCTTACATTTAAATCTTTAATGG + Intronic
910258298 1:85271969-85271991 TCCTACATGCAAAGGGCTCATGG + Intronic
910337058 1:86145974-86145996 TCTTACATTCTCATGGTACTGGG + Intronic
910824049 1:91386947-91386969 TCTTACATTGAAATGGTTATTGG - Intronic
912131776 1:106611869-106611891 TCTTATATGGACATGGTTCATGG + Intergenic
912339965 1:108904167-108904189 TCAGACCTTCAAATGGTTCTTGG + Exonic
913969039 1:143400315-143400337 ACTGAATTTCAAATGGTTCAGGG - Intergenic
914063416 1:144225914-144225936 ACTGAATTTCAAATGGTTCAGGG - Intergenic
914115734 1:144740440-144740462 ACTGAATTTCAAATGGTTCAGGG + Intergenic
915895932 1:159810812-159810834 TCTTACAGTGAACTGGCTCAAGG - Intronic
916106549 1:161436779-161436801 TCCTTCATTCAAAGGGTTCTGGG + Intergenic
916347070 1:163805278-163805300 CCTTATATTCTAATGTTTCATGG + Intergenic
916828734 1:168469162-168469184 TATTACAATGAAATGGTTGAGGG + Intergenic
919093908 1:193006725-193006747 TCTTACATGGGCATGGTTCATGG + Intergenic
919202877 1:194380635-194380657 TCTTACCTTCAAATAGTCAAAGG - Intergenic
919426254 1:197435185-197435207 TCTTACTTTGAAAATGTTCATGG + Exonic
922587515 1:226746030-226746052 TTTTTCATTCACATGTTTCATGG + Intergenic
923579296 1:235192433-235192455 TCCTACATGCAAATAGTGCATGG - Intronic
923987112 1:239393675-239393697 TCTAACATTCAAATGAATCAAGG - Intronic
1064168286 10:13005289-13005311 TCTTCCACTCATATGGTTTATGG - Intronic
1064920586 10:20513098-20513120 TCTTACATTCATATATTGCACGG + Intergenic
1066429761 10:35340471-35340493 TTTTACCTTAAAATGGTTGATGG + Intronic
1068700396 10:60013764-60013786 TCTTACATAAGAGTGGTTCATGG + Intergenic
1069208567 10:65725624-65725646 ACTTATATCCAAATGCTTCAAGG - Intergenic
1071586388 10:86826112-86826134 GCTTACTTTCAAATGGCTCAGGG - Intronic
1073781054 10:106838926-106838948 TCTTACATGGGCATGGTTCAGGG - Intronic
1074817269 10:117151827-117151849 TCTTAGATTCAGATGCCTCAAGG - Intergenic
1074919641 10:117993969-117993991 ACCTACATTCAAATGGTTCAGGG - Intergenic
1075803551 10:125168539-125168561 ACTTACCTTTAGATGGTTCAGGG - Intergenic
1077904716 11:6521521-6521543 TCTTACCTTCAAAATGTTTAGGG + Intronic
1078739968 11:14057617-14057639 ACTTACTCTCAAATGCTTCAGGG + Intronic
1079285023 11:19121161-19121183 ACTTACTTTCCAAAGGTTCATGG + Intronic
1080306462 11:30841855-30841877 ACTTACTTTCGAATGGTTCAGGG + Intronic
1080848020 11:36043406-36043428 TCTTACTTGCAAATTGTTAAAGG - Intronic
1081825035 11:46041808-46041830 GCGTACTTTCAGATGGTTCATGG - Intronic
1082121118 11:48380805-48380827 CCTTTCTTTCAAATGCTTCAGGG + Intergenic
1083123439 11:60538624-60538646 ACTTACCTTCAAATAATTCAGGG - Intronic
1088881343 11:113975704-113975726 GCTTTCATTCAAATAGTTTAGGG - Intronic
1089219808 11:116861177-116861199 TCTGCCTTTCAAATGGTTTATGG + Intronic
1089237803 11:117047641-117047663 TGTTGCATTAAAATAGTTCAGGG + Intronic
1089859884 11:121579916-121579938 TCTTGAATTCAAATGGGTCTGGG + Intronic
1094256778 12:28439336-28439358 TCTTAAAATAAAATGATTCACGG - Intronic
1096735856 12:53653728-53653750 CCTTACCAGCAAATGGTTCAGGG - Intronic
1097427188 12:59460704-59460726 TGTTACATCCAAATGTATCATGG - Intergenic
1098698907 12:73597550-73597572 ACTGACATTCAAAAGGTTAAAGG + Intergenic
1099335853 12:81356258-81356280 TCTTATATTGGCATGGTTCATGG + Intronic
1099438120 12:82667915-82667937 TCCTACATTCAAATAGTACCTGG + Intergenic
1100726231 12:97411877-97411899 TCTTACATCCATACAGTTCATGG - Intergenic
1100961379 12:99966309-99966331 ACTTACTTGCAAATGGTTCGGGG + Intronic
1101903473 12:108808448-108808470 TCTTCCAATCAGGTGGTTCACGG + Intronic
1104534068 12:129601742-129601764 TCTTACATGGGCATGGTTCATGG + Intronic
1106149916 13:27089338-27089360 ACTTATTTTCAAATGGTTTAGGG + Intronic
1106685104 13:32050177-32050199 TTTGACATTTAAATGGTTTAAGG - Intronic
1107197543 13:37671042-37671064 TCTTGCCTTCAAGTGGGTCACGG - Intronic
1107714110 13:43181295-43181317 TCTTAAACCCAAATTGTTCATGG + Intergenic
1107983788 13:45757468-45757490 TCTTTCATTCAAGGGGTTCTGGG + Intergenic
1108324309 13:49314866-49314888 CCATGCATTCAAATGGTACATGG + Intronic
1109712886 13:66182401-66182423 CCTTTCATTCAAAGGGTTCTGGG + Intergenic
1110942675 13:81369643-81369665 CCTTTCATTCAAAAGGTTCTGGG + Intergenic
1111425618 13:88077179-88077201 TTTTACATTCAAATAAATCAGGG - Intergenic
1111601969 13:90485858-90485880 TGTTACATTCAAATGTTTATGGG - Intergenic
1112774408 13:102828715-102828737 TCTTAAATACAACTGGTACATGG - Intronic
1113277191 13:108744019-108744041 GTATACATTTAAATGGTTCAAGG + Intronic
1113554956 13:111225710-111225732 TCTTACATGGGCATGGTTCATGG - Intronic
1114866749 14:26604626-26604648 TTTCACATCCAAATGGTTTATGG - Intergenic
1115803036 14:37017404-37017426 TTTTACATGTACATGGTTCATGG + Intronic
1115952428 14:38736192-38736214 TCTGTCTTTCATATGGTTCAGGG + Intergenic
1116246658 14:42423614-42423636 TCTTACATTGAAATTTTTCAGGG - Intergenic
1117455057 14:55888639-55888661 TCATACAGGTAAATGGTTCATGG - Intergenic
1117582324 14:57164491-57164513 TCTTCCTTTCAAATGCTTTAAGG - Intergenic
1118155369 14:63235501-63235523 ATTTACTTTCAAATGGTTCAGGG + Intronic
1118866370 14:69707288-69707310 CCTTACTTTTAGATGGTTCAGGG + Intronic
1120047643 14:79826511-79826533 ACTGAGTTTCAAATGGTTCAGGG - Intronic
1120276717 14:82384535-82384557 TCTAAAATTCAACAGGTTCAAGG + Intergenic
1120683464 14:87509210-87509232 TCTTACATGCAACAGCTTCAGGG - Intergenic
1121705782 14:95992568-95992590 TCCAGAATTCAAATGGTTCAGGG - Intergenic
1122194160 14:100072666-100072688 GCTGACTTTCAAATGGCTCAGGG + Intronic
1122832273 14:104404736-104404758 TCTTATATTCTATGGGTTCATGG - Intergenic
1123727660 15:23120636-23120658 ACTTACTTTGAAATGATTCAGGG - Intergenic
1123730599 15:23141222-23141244 ACTTACTTTGAAATGATTCAGGG + Intergenic
1123748737 15:23338648-23338670 ACTTACTTTGAAATGATTCAGGG + Intergenic
1124580381 15:30948724-30948746 TTTTACATTCGAATGGTTTGTGG + Intronic
1124639254 15:31385629-31385651 TCTTATATGGAAGTGGTTCATGG - Intronic
1124656476 15:31513262-31513284 GTTTATTTTCAAATGGTTCAGGG - Intronic
1124767053 15:32494675-32494697 ACTTACTTTGAAATGATTCAGGG + Intergenic
1125059947 15:35407521-35407543 GCTTACATTGTAATGGTACAGGG + Intronic
1128011237 15:64298631-64298653 TCTTAAATTCAAATGGTCTCTGG + Intronic
1129615122 15:77092632-77092654 GCTTACATTCAAATTGATAATGG - Intergenic
1130129840 15:81130918-81130940 TCTTATATGCCCATGGTTCATGG + Intronic
1131415675 15:92254842-92254864 CTTTACTTTCAAATGGCTCAGGG - Intergenic
1131681306 15:94726454-94726476 CCTTACAATGTAATGGTTCATGG + Intergenic
1133528404 16:6629071-6629093 TCTTTCATTTAAACTGTTCATGG - Intronic
1135625824 16:23993993-23994015 CCTTTCATTCAAAGGGTTCTGGG - Intronic
1137286571 16:47021132-47021154 TATTCCTCTCAAATGGTTCAAGG - Intergenic
1138009613 16:53365619-53365641 ACTTACTTTGAAATGATTCAGGG + Intergenic
1138487185 16:57353705-57353727 CCTTACTTTCAAAGAGTTCATGG - Intergenic
1138870258 16:60874720-60874742 TCATAAATTCAAATCATTCAAGG - Intergenic
1141459399 16:84168868-84168890 CTTTATCTTCAAATGGTTCAGGG - Intronic
1143058299 17:4178956-4178978 TCGTACATTCAAATGGATATCGG + Exonic
1143881772 17:10035386-10035408 TCTTACATTTTAAAGGTTCCCGG + Intronic
1145245641 17:21267621-21267643 ACTTACTTTCAAATGATTCAGGG + Intergenic
1147059568 17:37864454-37864476 TCTGTCATTCTAATGGATCAGGG - Intergenic
1147877419 17:43631598-43631620 TCTTGAAGACAAATGGTTCAGGG + Intergenic
1148066977 17:44878635-44878657 TTTTACTTTCAAACAGTTCAAGG + Intronic
1149892648 17:60403676-60403698 ACTTACTTTTAAATGCTTCAGGG + Intronic
1152349088 17:79773478-79773500 ACTTACAAACAAATAGTTCAGGG - Intergenic
1154130978 18:11736909-11736931 GCTTACTTTCAAATGGTTCAGGG + Intronic
1155189825 18:23419888-23419910 ACTTACTTTCAAAAAGTTCAGGG + Intronic
1155391785 18:25346493-25346515 TCTTACTTTCAAAAGGTTTCAGG + Intronic
1156184864 18:34650892-34650914 TTAAACATTCAAATGATTCAGGG - Intronic
1157053455 18:44197501-44197523 TCTTCCATTGAAATGGTTCCTGG + Intergenic
1158123818 18:54080174-54080196 GCTTACTCTCAAATAGTTCAAGG + Intergenic
1158154549 18:54410708-54410730 ACATACATGTAAATGGTTCATGG - Intergenic
1158256612 18:55557644-55557666 AAATACATTCACATGGTTCAAGG + Intronic
1158262973 18:55629798-55629820 TCTTACATTTCAATTGTGCATGG - Intronic
1166943417 19:46382660-46382682 ACTTACTTTCAAATGGGTTAGGG - Intronic
1167958272 19:53085692-53085714 TCATACATTAAAATGGATGATGG + Intronic
1168365792 19:55786046-55786068 TCTTACATTCTAATATTTAATGG - Intronic
926676413 2:15626238-15626260 TCCTGCATTCAAGTGGTTTAGGG - Intronic
927319365 2:21724530-21724552 TCTGAGATCCAGATGGTTCAAGG + Intergenic
929077103 2:38086919-38086941 ACTTACCCTCAAATGGCTCAAGG + Intronic
929369248 2:41202119-41202141 TGTTAATTTCAAAGGGTTCAAGG + Intergenic
930140546 2:47947467-47947489 TCGTATTTTCAAATGGTTCCCGG + Intergenic
931008578 2:57881217-57881239 CCTTATACTCAAATTGTTCATGG - Intergenic
931794378 2:65695248-65695270 TCTTGCATTCAAATGATTTTAGG - Intergenic
932857398 2:75250688-75250710 TCTTACATTAACATGGTTCATGG + Intergenic
933143028 2:78817098-78817120 TCCTACATTTAAATGATTGAGGG - Intergenic
933335941 2:80959658-80959680 TTTTACATTCAATTTGTTAATGG + Intergenic
933386019 2:81611137-81611159 TCTTGCATTCAAAAGGTACAAGG + Intergenic
934173741 2:89561235-89561257 ACTGAATTTCAAATGGTTCAGGG - Intergenic
934284055 2:91635584-91635606 ACTGAATTTCAAATGGTTCAGGG - Intergenic
934582424 2:95454677-95454699 ACTTACCCTCAAATGGTTCAAGG - Intergenic
934597026 2:95622037-95622059 ACTTACCCTCAAATGGTTCAAGG + Intergenic
934842852 2:97640975-97640997 ACTTACCCTCAAATGGTTCAAGG - Intergenic
936105827 2:109623650-109623672 TCTGACCTTGAAATGGCTCATGG + Intergenic
936780274 2:116024449-116024471 TTGAACATTCAAATGTTTCAAGG - Intergenic
937330441 2:121023798-121023820 ATTTACTCTCAAATGGTTCAGGG + Intergenic
939139848 2:138341724-138341746 TCTTATATTCCAAAAGTTCAAGG - Intergenic
939653376 2:144791473-144791495 TCTTACATTGGTGTGGTTCATGG + Intergenic
940840267 2:158571807-158571829 TGTTACGTGAAAATGGTTCAAGG + Intronic
941132244 2:161666854-161666876 TGTTACTATTAAATGGTTCATGG - Intronic
942341307 2:174950700-174950722 TCTTACATTAAAAATGTGCAGGG + Intronic
942702806 2:178732605-178732627 TCTCACAATCAGATGGTTTAAGG - Exonic
943466165 2:188231476-188231498 TCCTCCATCCAAATGTTTCATGG - Intergenic
943834716 2:192504640-192504662 GCTTACATTCAAAAGGATCCAGG - Intergenic
943903546 2:193471099-193471121 TCTTACACTCAAATCTCTCAGGG - Intergenic
944919846 2:204401461-204401483 CCTGAAAATCAAATGGTTCATGG - Intergenic
945680295 2:212905625-212905647 TTTGACATTTAAAGGGTTCATGG + Intergenic
948471032 2:238179335-238179357 TCTTCCTTTCAAATGGATAAAGG + Intronic
1170525564 20:17232831-17232853 TCTTAGATTGAAATCTTTCAGGG - Intronic
1170742783 20:19072762-19072784 TCCTACATGCAATTGTTTCAGGG - Intergenic
1171149388 20:22813813-22813835 ACTTACTCTCAAATGGTTCAGGG + Intergenic
1172935710 20:38618649-38618671 ACCTACACTCAAATGATTCAAGG + Intronic
1174027618 20:47591472-47591494 TCTTACTGTCAAATGGGTGATGG - Intronic
1174652551 20:52140062-52140084 TCTTATATGGACATGGTTCATGG - Intronic
1175007285 20:55698520-55698542 TCTTAGATTCAGAGGGTACATGG + Intergenic
1175614538 20:60384277-60384299 TCTTACCAACAAATGGTTTAGGG + Intergenic
1177044030 21:16146931-16146953 TCTTACATGCAGGAGGTTCATGG - Intergenic
1181325512 22:22042651-22042673 TCTAACTTTCAAATAGCTCATGG - Intergenic
949587178 3:5453347-5453369 ATTGACATTCACATGGTTCAAGG - Intergenic
950389887 3:12688237-12688259 TCTTATCTTCAAATGGAGCAAGG + Intergenic
951768044 3:26222292-26222314 TCTCACTTTCAGATGCTTCAAGG - Intergenic
953325849 3:42012166-42012188 GCTTACCTTCAAATGATTCAGGG - Intergenic
953593459 3:44283781-44283803 ACTTAACTTCAAGTGGTTCAGGG - Intronic
956104238 3:65800272-65800294 TCTTACATTTAAAGGTGTCAGGG + Intronic
956133444 3:66075771-66075793 GCTTAAAGTCAAATGGTCCAAGG - Intergenic
956542370 3:70355270-70355292 TCTTACATACAAATAAATCAAGG + Intergenic
958450197 3:94263723-94263745 TCATGCAGTCTAATGGTTCAGGG - Intergenic
959031241 3:101301150-101301172 TCTTACATGGATATTGTTCATGG + Intronic
959585593 3:108022339-108022361 TCATACATTGACATGGTTCCAGG + Intergenic
960439187 3:117665894-117665916 TCTTATATTTATATGGTTCTAGG + Intergenic
960703917 3:120463740-120463762 ATTTATTTTCAAATGGTTCAGGG + Intergenic
964077985 3:152715005-152715027 TCTTACTCTCAAGTAGTTCAAGG - Intergenic
965379933 3:167975583-167975605 TCTTTCTTTCAAATGCCTCAAGG - Intergenic
965685879 3:171301916-171301938 ACTTACTTTCAAATGGTTCAGGG + Intronic
966858151 3:184210551-184210573 ACTTACTTGTAAATGGTTCATGG + Intronic
967333344 3:188315619-188315641 GCTTACATTCTAATGGGTCTGGG - Intronic
969827604 4:9770063-9770085 ACTGAATTTCAAATGGTTCAGGG - Intergenic
971656807 4:29357916-29357938 TGTTACATCCAATTGGTTTATGG + Intergenic
972439032 4:39067014-39067036 TCTCACATTAATATGGTGCATGG + Intronic
972701585 4:41499326-41499348 TCTTACATTCAAATGGTTCAGGG - Intronic
972836322 4:42874940-42874962 TTTTACACACAAATGATTCAAGG + Intergenic
974324100 4:60391781-60391803 TCTTACATTCTGTTGGATCAAGG + Intergenic
974405900 4:61469047-61469069 TCTAATATTCTAATGGTTCCTGG - Intronic
975790887 4:77949112-77949134 TATTACATTCAAATGTTTACAGG - Intronic
975847447 4:78539968-78539990 TCCTCCATTAAAATGCTTCATGG - Intronic
975850476 4:78566764-78566786 TCTTACATGCAGATGGTGCATGG - Intronic
976714317 4:88107099-88107121 TCTTAAATTCAAATTCTTAATGG + Intronic
978593954 4:110356530-110356552 TCTTGCCTGCAAATGGGTCAGGG + Intergenic
979619323 4:122780803-122780825 TCTTATATGGACATGGTTCATGG + Intergenic
980698066 4:136385818-136385840 TTAGACATTCAAAGGGTTCAGGG + Intergenic
981026490 4:140082183-140082205 TTTCACAGTCAAAGGGTTCAAGG + Intronic
981438023 4:144749212-144749234 TCTTTCATCCACATGGATCATGG - Intergenic
982393428 4:154891067-154891089 TCTCACCTCCTAATGGTTCATGG + Intergenic
983741124 4:171135748-171135770 TCTTACATTCAATAGGTTCCAGG - Intergenic
985481757 5:116282-116304 TCTTATATTGGCATGGTTCATGG + Intergenic
988768797 5:34410239-34410261 TCTGACATTCAAATGTTGAAAGG - Intergenic
989224846 5:39014760-39014782 TGTGACATTCACATGGTTAAAGG + Intronic
989375978 5:40761387-40761409 TGTAACATCCAAATGGTTCAGGG + Intronic
990855624 5:60263569-60263591 TCTTGCAATAAAATGCTTCATGG + Intronic
991171618 5:63633144-63633166 TCTTACATGGATATGGTTCATGG + Intergenic
993012333 5:82497775-82497797 TCTTACATTCATTTAGTTGATGG - Intergenic
993589097 5:89771700-89771722 TGTTAGCTACAAATGGTTCATGG + Intergenic
993661947 5:90648412-90648434 CCTTACTCTCAAAAGGTTCAAGG - Intronic
993713135 5:91247747-91247769 ATTTACATTAAAATGGTTCTAGG + Intergenic
999518716 5:152328326-152328348 TCTTTCACTCAAATGGTTTCTGG - Intergenic
1000131889 5:158308074-158308096 TCTTATAATGAAATGGTTCTTGG + Intergenic
1004255476 6:14059592-14059614 TCTAACACTGAAATAGTTCAGGG + Intergenic
1005342019 6:24851948-24851970 TCTTGCTCTAAAATGGTTCAGGG + Intronic
1005938003 6:30538943-30538965 TCCAACTTTCAAATGGTTCAGGG + Intergenic
1009349737 6:62659863-62659885 TCCTAAATTAAAATGGTTCTCGG - Intergenic
1009963380 6:70551805-70551827 TCTTACATAGGCATGGTTCATGG + Intronic
1011571866 6:88746470-88746492 TCTTACATAAAACTGGTTCCTGG - Intronic
1013581986 6:111544775-111544797 TCTTCCTTTCAAATGGTTCAGGG - Intergenic
1013802197 6:113960065-113960087 ACATAAATTCAAATAGTTCATGG - Intronic
1014892311 6:126857624-126857646 GCTTAGATTCAACTGGTTGATGG - Intergenic
1015442013 6:133259509-133259531 TTTTATATTCAAATGCTACAGGG + Intronic
1015559677 6:134501318-134501340 TCTTACATGGAAATGGATGAAGG - Intergenic
1017438506 6:154440782-154440804 ATTTACATCCAAATGGGTCAGGG - Intronic
1018489601 6:164278712-164278734 TAGTACATTCAATTGGTACAGGG + Intergenic
1018493531 6:164322987-164323009 TCTAACATTCAATTAATTCAAGG + Intergenic
1019040580 6:169100943-169100965 TCCTTCATTCAAAAGGTTCTGGG - Intergenic
1022873641 7:34505522-34505544 GCTTACTCTCAAATGGTTTAGGG - Intergenic
1023276081 7:38519966-38519988 TCTTAGATTCAGAGGGTTCATGG - Intronic
1024730848 7:52252278-52252300 TATTGCATTCAGATGTTTCAAGG - Intergenic
1026773203 7:73214853-73214875 TCATTCATTCACATTGTTCAAGG + Intergenic
1027014065 7:74768249-74768271 TCATTCATTCACATTGTTCAAGG + Intergenic
1027073972 7:75177783-75177805 TCATTCATTCACATTGTTCAAGG - Intergenic
1027813605 7:82939499-82939521 TATGACATTAAAATAGTTCAGGG + Intronic
1032206930 7:129874135-129874157 TCTTACATTTAAATGATTATTGG - Intronic
1032227537 7:130045212-130045234 GCTTACTTTCAAATAGCTCAGGG + Intronic
1032840452 7:135709332-135709354 ACTTACCCTCAAATGGTTCAGGG - Intronic
1034390330 7:150782081-150782103 ACTGACATACAACTGGTTCAGGG + Intergenic
1035409489 7:158627656-158627678 TATTACCTTCTAATGGTGCAGGG + Intergenic
1036987215 8:13548063-13548085 TCTTGCATTCAAATAACTCAGGG - Intergenic
1037022912 8:13995911-13995933 ACTTACCTTCAAAGGGTTTAAGG - Intergenic
1038874369 8:31532029-31532051 TCTTATCTTCTAATGGTTGAAGG + Intergenic
1039116360 8:34095482-34095504 ACTTAGATTCAAGTGGCTCAAGG + Intergenic
1039623039 8:39018109-39018131 TCTTAGACTGAAATGGTTCTAGG + Intronic
1040902165 8:52428260-52428282 TCTAAAATACAAATGGATCAAGG + Intronic
1040966868 8:53091232-53091254 TCTTACATTTAAGTGTTTGATGG + Intergenic
1042511495 8:69617030-69617052 TCTTAAATCCAAATGGTTTAAGG - Intronic
1042897831 8:73690608-73690630 ATTTACTTTCAAATTGTTCAAGG + Intronic
1044576067 8:93770261-93770283 ACTTATTTTCAAATGGCTCAGGG - Intronic
1045183189 8:99808825-99808847 TCTTACATTTAAAATGTTGAGGG + Intronic
1045595922 8:103656506-103656528 TCCTACTCTCAAATAGTTCATGG + Intronic
1046197356 8:110882731-110882753 CCTTTCATTCAAAGGGTTCTGGG - Intergenic
1047564958 8:126033979-126034001 CCTTTCATTCAAAGGGTTCTGGG + Intergenic
1047766633 8:127995212-127995234 TCTTACAGTCACTTGATTCAGGG - Intergenic
1048408201 8:134144109-134144131 TCTCATATTCAACTGTTTCAGGG + Intergenic
1050732991 9:8730760-8730782 TCTTACAGCCGAATGGTTCTCGG + Intronic
1051085039 9:13338517-13338539 TCTTACATGGGCATGGTTCATGG + Intergenic
1051314393 9:15812510-15812532 TCTTACTTTCAAATATTTGAGGG - Intronic
1054951307 9:70854992-70855014 TCTTTCATTCAAATGGCAGAGGG + Intronic
1055466593 9:76572509-76572531 ACTTACTATCAACTGGTTCAAGG - Intergenic
1055929665 9:81546852-81546874 TCTGACACTCAAAAGGCTCAAGG - Intergenic
1056770711 9:89476100-89476122 TCTTACATTCTAATGGCACCAGG - Intronic
1056995325 9:91452005-91452027 GCTTCCATTCAGATGGTTGAGGG - Intergenic
1057017438 9:91665049-91665071 TCTTCTTTTCAAATGGTTCTGGG - Intronic
1057504491 9:95621501-95621523 TCTTTTATTGGAATGGTTCATGG - Intergenic
1057960981 9:99456819-99456841 TCTAACTTTCAAATGGTTTGGGG + Intergenic
1059719718 9:116947681-116947703 ACTTACTCTCCAATGGTTCATGG - Intronic
1060659826 9:125398354-125398376 ACTTACTTTCAAATGGCTCAGGG + Intergenic
1185724810 X:2411183-2411205 GCTTACATTTAAAAAGTTCATGG - Intronic
1187269182 X:17764615-17764637 TCTGACATTCAGAGGGTTCTTGG - Intergenic
1187314026 X:18175097-18175119 TTTTACATTCAAATTGTTTAGGG + Intronic
1187320335 X:18232048-18232070 TCTGACATTCAGAGGGTTCTTGG + Intergenic
1187864152 X:23708866-23708888 ACTTACTTTCCAATGATTCATGG + Intronic
1188159899 X:26786262-26786284 TCTAACAATGAAATGATTCAGGG - Intergenic
1188924869 X:36027230-36027252 TCTTACATGCATATGTTGCATGG + Intergenic
1189265546 X:39713317-39713339 TCTTACACTCAAGAAGTTCAGGG - Intergenic
1189486763 X:41439602-41439624 TGTTAAATTCATATTGTTCATGG - Intergenic
1192240721 X:69325412-69325434 TCCTAGATTCAAATGATTTAAGG + Intergenic
1192452930 X:71254555-71254577 CCTCTCATTCAAATGGTTCCCGG + Intronic
1193424061 X:81319353-81319375 TCCTACTTTGATATGGTTCAAGG - Intergenic
1194750072 X:97674101-97674123 ACTTACCCTTAAATGGTTCAGGG - Intergenic
1195043807 X:101037987-101038009 TCTTACATCCAAATGCTCAATGG - Exonic
1195271521 X:103235846-103235868 ACTTACCTTCAAATAATTCAGGG + Intergenic
1195822412 X:108960327-108960349 GACTACATTCAAATGTTTCAGGG + Intergenic
1197167879 X:123398412-123398434 TATTACAATCAAATGGCTCAAGG - Intronic
1198324135 X:135550716-135550738 TCTTACATTCAGGTCTTTCATGG - Intronic
1199120227 X:144043803-144043825 TATTACATTAAAATGGTTACCGG + Intergenic
1199504594 X:148547462-148547484 TCTTACTTTCAGCTAGTTCATGG - Intronic
1199773625 X:150991714-150991736 TCTTAGTTTCAGATTGTTCATGG - Intergenic
1200692140 Y:6317123-6317145 TTTTACATTCAAATGAATAAAGG - Intergenic
1200948111 Y:8865959-8865981 TAACACATTCAAATGGTTCCCGG - Intergenic
1201043132 Y:9857604-9857626 TTTTACATTCAAATGAATAAAGG + Intergenic
1201570072 Y:15404163-15404185 ACTGAGATTCAACTGGTTCATGG - Intergenic
1202162612 Y:21951465-21951487 TTTTACATTCAAATGAATAAAGG - Intergenic
1202228744 Y:22634903-22634925 TTTTACATTCAAATGAATAAAGG + Intergenic
1202314412 Y:23561264-23561286 TTTTACATTCAAATGAATAAAGG - Intergenic
1202556390 Y:26109331-26109353 TTTTACATTCAAATGAATAAAGG + Intergenic