ID: 972701607

View in Genome Browser
Species Human (GRCh38)
Location 4:41499540-41499562
Sequence TAGGCGTGAGCCATCGCTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157843
Summary {0: 7, 1: 149, 2: 3773, 3: 47074, 4: 106840}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972701607_972701611 -1 Left 972701607 4:41499540-41499562 CCGGGAGCGATGGCTCACGCCTA 0: 7
1: 149
2: 3773
3: 47074
4: 106840
Right 972701611 4:41499562-41499584 ATAATTCTAGCACTTTGGAAGGG 0: 2
1: 8
2: 115
3: 967
4: 3758
972701607_972701618 20 Left 972701607 4:41499540-41499562 CCGGGAGCGATGGCTCACGCCTA 0: 7
1: 149
2: 3773
3: 47074
4: 106840
Right 972701618 4:41499583-41499605 GGCAAGGTGGGGGGATCATGAGG 0: 1
1: 29
2: 1679
3: 10154
4: 34507
972701607_972701610 -2 Left 972701607 4:41499540-41499562 CCGGGAGCGATGGCTCACGCCTA 0: 7
1: 149
2: 3773
3: 47074
4: 106840
Right 972701610 4:41499561-41499583 TATAATTCTAGCACTTTGGAAGG 0: 10
1: 417
2: 8289
3: 81013
4: 367429
972701607_972701614 8 Left 972701607 4:41499540-41499562 CCGGGAGCGATGGCTCACGCCTA 0: 7
1: 149
2: 3773
3: 47074
4: 106840
Right 972701614 4:41499571-41499593 GCACTTTGGAAGGGCAAGGTGGG 0: 6
1: 1446
2: 36261
3: 142567
4: 241799
972701607_972701612 4 Left 972701607 4:41499540-41499562 CCGGGAGCGATGGCTCACGCCTA 0: 7
1: 149
2: 3773
3: 47074
4: 106840
Right 972701612 4:41499567-41499589 TCTAGCACTTTGGAAGGGCAAGG 0: 2
1: 21
2: 1169
3: 17926
4: 122031
972701607_972701615 9 Left 972701607 4:41499540-41499562 CCGGGAGCGATGGCTCACGCCTA 0: 7
1: 149
2: 3773
3: 47074
4: 106840
Right 972701615 4:41499572-41499594 CACTTTGGAAGGGCAAGGTGGGG 0: 1
1: 28
2: 595
3: 2014
4: 4693
972701607_972701613 7 Left 972701607 4:41499540-41499562 CCGGGAGCGATGGCTCACGCCTA 0: 7
1: 149
2: 3773
3: 47074
4: 106840
Right 972701613 4:41499570-41499592 AGCACTTTGGAAGGGCAAGGTGG 0: 11
1: 2503
2: 64100
3: 154424
4: 160994
972701607_972701608 -6 Left 972701607 4:41499540-41499562 CCGGGAGCGATGGCTCACGCCTA 0: 7
1: 149
2: 3773
3: 47074
4: 106840
Right 972701608 4:41499557-41499579 CGCCTATAATTCTAGCACTTTGG 0: 35
1: 1651
2: 26709
3: 188285
4: 302850
972701607_972701617 11 Left 972701607 4:41499540-41499562 CCGGGAGCGATGGCTCACGCCTA 0: 7
1: 149
2: 3773
3: 47074
4: 106840
Right 972701617 4:41499574-41499596 CTTTGGAAGGGCAAGGTGGGGGG 0: 8
1: 1132
2: 25663
3: 79938
4: 159545
972701607_972701616 10 Left 972701607 4:41499540-41499562 CCGGGAGCGATGGCTCACGCCTA 0: 7
1: 149
2: 3773
3: 47074
4: 106840
Right 972701616 4:41499573-41499595 ACTTTGGAAGGGCAAGGTGGGGG 0: 1
1: 26
2: 624
3: 2031
4: 4508

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972701607 Original CRISPR TAGGCGTGAGCCATCGCTCC CGG (reversed) Intronic
Too many off-targets to display for this crispr