ID: 972701609

View in Genome Browser
Species Human (GRCh38)
Location 4:41499559-41499581
Sequence TTCCAAAGTGCTAGAATTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 452931
Summary {0: 10, 1: 432, 2: 8397, 3: 81139, 4: 362953}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972701609_972701619 24 Left 972701609 4:41499559-41499581 CCTATAATTCTAGCACTTTGGAA 0: 10
1: 432
2: 8397
3: 81139
4: 362953
Right 972701619 4:41499606-41499628 TCAAGAGATCGAGTCCATCCTGG 0: 16
1: 6253
2: 65301
3: 66323
4: 96282
972701609_972701615 -10 Left 972701609 4:41499559-41499581 CCTATAATTCTAGCACTTTGGAA 0: 10
1: 432
2: 8397
3: 81139
4: 362953
Right 972701615 4:41499572-41499594 CACTTTGGAAGGGCAAGGTGGGG 0: 1
1: 28
2: 595
3: 2014
4: 4693
972701609_972701616 -9 Left 972701609 4:41499559-41499581 CCTATAATTCTAGCACTTTGGAA 0: 10
1: 432
2: 8397
3: 81139
4: 362953
Right 972701616 4:41499573-41499595 ACTTTGGAAGGGCAAGGTGGGGG 0: 1
1: 26
2: 624
3: 2031
4: 4508
972701609_972701618 1 Left 972701609 4:41499559-41499581 CCTATAATTCTAGCACTTTGGAA 0: 10
1: 432
2: 8397
3: 81139
4: 362953
Right 972701618 4:41499583-41499605 GGCAAGGTGGGGGGATCATGAGG 0: 1
1: 29
2: 1679
3: 10154
4: 34507
972701609_972701617 -8 Left 972701609 4:41499559-41499581 CCTATAATTCTAGCACTTTGGAA 0: 10
1: 432
2: 8397
3: 81139
4: 362953
Right 972701617 4:41499574-41499596 CTTTGGAAGGGCAAGGTGGGGGG 0: 8
1: 1132
2: 25663
3: 79938
4: 159545

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972701609 Original CRISPR TTCCAAAGTGCTAGAATTAT AGG (reversed) Intronic
Too many off-targets to display for this crispr