ID: 972701617

View in Genome Browser
Species Human (GRCh38)
Location 4:41499574-41499596
Sequence CTTTGGAAGGGCAAGGTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266286
Summary {0: 8, 1: 1132, 2: 25663, 3: 79938, 4: 159545}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972701607_972701617 11 Left 972701607 4:41499540-41499562 CCGGGAGCGATGGCTCACGCCTA 0: 7
1: 149
2: 3773
3: 47074
4: 106840
Right 972701617 4:41499574-41499596 CTTTGGAAGGGCAAGGTGGGGGG 0: 8
1: 1132
2: 25663
3: 79938
4: 159545
972701609_972701617 -8 Left 972701609 4:41499559-41499581 CCTATAATTCTAGCACTTTGGAA 0: 10
1: 432
2: 8397
3: 81139
4: 362953
Right 972701617 4:41499574-41499596 CTTTGGAAGGGCAAGGTGGGGGG 0: 8
1: 1132
2: 25663
3: 79938
4: 159545

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972701617 Original CRISPR CTTTGGAAGGGCAAGGTGGG GGG Intronic
Too many off-targets to display for this crispr