ID: 972707762

View in Genome Browser
Species Human (GRCh38)
Location 4:41562083-41562105
Sequence ACACCTGAAAAAGGGTACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 125}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972707762_972707770 2 Left 972707762 4:41562083-41562105 CCAAGGTACCCTTTTTCAGGTGT 0: 1
1: 0
2: 1
3: 5
4: 125
Right 972707770 4:41562108-41562130 CTGGTGCCAGGGCCAGATATGGG 0: 1
1: 0
2: 0
3: 21
4: 195
972707762_972707766 -10 Left 972707762 4:41562083-41562105 CCAAGGTACCCTTTTTCAGGTGT 0: 1
1: 0
2: 1
3: 5
4: 125
Right 972707766 4:41562096-41562118 TTTCAGGTGTTCCTGGTGCCAGG No data
972707762_972707767 -9 Left 972707762 4:41562083-41562105 CCAAGGTACCCTTTTTCAGGTGT 0: 1
1: 0
2: 1
3: 5
4: 125
Right 972707767 4:41562097-41562119 TTCAGGTGTTCCTGGTGCCAGGG 0: 1
1: 0
2: 2
3: 26
4: 378
972707762_972707769 1 Left 972707762 4:41562083-41562105 CCAAGGTACCCTTTTTCAGGTGT 0: 1
1: 0
2: 1
3: 5
4: 125
Right 972707769 4:41562107-41562129 CCTGGTGCCAGGGCCAGATATGG 0: 1
1: 0
2: 6
3: 42
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972707762 Original CRISPR ACACCTGAAAAAGGGTACCT TGG (reversed) Intronic
906320196 1:44810894-44810916 ACACATGAAAATGCTTACCTGGG + Intronic
906664621 1:47611328-47611350 ACAGGTGAAAAATGGTATCTTGG - Intergenic
911482363 1:98460040-98460062 ACACCTGTAAAATGGAACCAAGG + Intergenic
913446906 1:118959863-118959885 ACACCTGGAATATAGTACCTTGG + Intronic
916211236 1:162361646-162361668 ATACCTGAAATAGTGTAACTGGG + Intronic
917999774 1:180481588-180481610 ATTCCTGAAAAAAGCTACCTGGG - Intronic
919516160 1:198526807-198526829 AAACCTGAAAATGGTTGCCTTGG - Intronic
921497103 1:215854895-215854917 CCAACAGAAAAAGGCTACCTGGG - Intronic
922032226 1:221812542-221812564 CCACCAGAAAAACAGTACCTGGG - Intergenic
924822511 1:247506958-247506980 CCACCTGAGCAAGGCTACCTGGG + Intergenic
1063803548 10:9610870-9610892 ACAATTGAAAATGGGTACGTGGG + Intergenic
1063818325 10:9803825-9803847 ACAACTAAAAAAGGACACCTGGG + Intergenic
1065443734 10:25776104-25776126 CCAACAGAAAAGGGGTACCTAGG - Intergenic
1069961210 10:72080561-72080583 ACACCTGGGAGAGGGCACCTGGG + Intronic
1073454565 10:103628740-103628762 ACACCTGAAAAAAGGAAGCCTGG + Intronic
1078059992 11:8037072-8037094 ACACCTGAAAGAGAGTTTCTGGG + Intronic
1078862585 11:15264079-15264101 ACCTTTGAAAAAGAGTACCTTGG - Intergenic
1078862623 11:15264403-15264425 ACCTTTGAAAAAGAGTACCTTGG - Intergenic
1078862660 11:15264729-15264751 ACCTTTGAAAAAGAGTACCTTGG - Intergenic
1079011140 11:16829315-16829337 ACAACTGAAAAAGGGAATTTAGG - Intronic
1080945588 11:36970024-36970046 ACACCTGAAACAGTTTACCTAGG + Intergenic
1081714879 11:45242771-45242793 ACACCTGAACCAGGATTCCTGGG - Exonic
1086135649 11:83441598-83441620 AAACTTGAAAAACAGTACCTGGG + Intergenic
1086406741 11:86505234-86505256 AAACCTTTAAAAGGGCACCTAGG + Intronic
1086812762 11:91331591-91331613 ACACCTGATAAAGAGTAAGTTGG + Intergenic
1089338477 11:117741968-117741990 ACCCCTGAGAAAGGTTACCCTGG + Intronic
1090750409 11:129741943-129741965 ACAGGTGAAAAATGGTATCTTGG + Intergenic
1091299412 11:134497983-134498005 AGACCAAAAAAAGGGTTCCTTGG + Intergenic
1095104635 12:38217007-38217029 CCACCTTAATAAGGCTACCTGGG + Intergenic
1095231392 12:39744020-39744042 ACCCCTCAAAATGGATACCTAGG + Intronic
1097984302 12:65767718-65767740 AGATCTGAAAAAGGGTAACCAGG + Intergenic
1100189605 12:92176682-92176704 ACAACAGGAAAAGGCTACCTGGG + Intergenic
1100233114 12:92630136-92630158 ACAGTTGAAAATTGGTACCTAGG - Intergenic
1100262138 12:92942301-92942323 AAACCTGATAAAGGGCACGTTGG + Intergenic
1101632467 12:106508593-106508615 ACAACTGTAGAAGGGTCCCTGGG - Intronic
1104404180 12:128503950-128503972 ACAACTGCAAAAGGGTTCATGGG - Intronic
1110161521 13:72384093-72384115 AAACCTGAATAATGGTTCCTAGG + Intergenic
1119936661 14:78598286-78598308 ACACGTGAGCAAGGGTTCCTGGG + Intronic
1122066449 14:99177029-99177051 ACACCTGAATATGGATTCCTAGG + Intronic
1123783839 15:23649151-23649173 ACCCCTGGCTAAGGGTACCTGGG - Intergenic
1129899600 15:79136427-79136449 ACACTTGAAAATGGGAAACTTGG - Intergenic
1135966108 16:27036518-27036540 GGTCCTGAAAAAGTGTACCTAGG - Intergenic
1136461555 16:30414092-30414114 TCACCTGAAAGAGGGTGCCAAGG + Intronic
1143162834 17:4882476-4882498 ACAGCTGCAACAGGGAACCTGGG - Intronic
1147307596 17:39574393-39574415 ACACCTTAAAAAGAGCATCTGGG + Intergenic
1149615789 17:57997061-57997083 ATGACTGAAAAAGGATACCTAGG + Intronic
1156451281 18:37267733-37267755 CCACTAGAAAAAGGGCACCTGGG + Intronic
1156675027 18:39517379-39517401 ACACCTACAAAATGGTCCCTAGG + Intergenic
1157799605 18:50608823-50608845 ACAAGTGAACAAGGGTATCTGGG + Intronic
1158957956 18:62559638-62559660 ACACCTGCAAAAGGGGACATGGG + Intronic
1159549183 18:69877208-69877230 AAACCTGAAAAAGGGGTCTTGGG - Intronic
1160313916 18:77822559-77822581 GCACCTGAAAATGTGTGCCTGGG + Intergenic
1160764522 19:801525-801547 AAACCTTAAAAAGGGCATCTTGG - Intronic
1161600981 19:5182557-5182579 CCACCTGTTGAAGGGTACCTGGG + Intronic
1162962379 19:14135947-14135969 CCCCATGAAAACGGGTACCTAGG + Intronic
1164334262 19:24295720-24295742 GAATCTGCAAAAGGGTACCTGGG + Intergenic
1164903938 19:31951554-31951576 ACACACGAAAAAGAGTGCCTTGG + Intergenic
926720046 2:15953122-15953144 AAACCTGAAAACGGGTACCTTGG + Intergenic
932011355 2:67980714-67980736 GCATCTGAGAAATGGTACCTGGG + Intergenic
933516104 2:83304319-83304341 ACACAAGAAAAATGGTACTTAGG - Intergenic
937681825 2:124652406-124652428 CCCACTGAAAAAGGCTACCTTGG + Intronic
937797201 2:126037810-126037832 ACAGCTGAAAATGGGAACCCAGG - Intergenic
938945110 2:136205210-136205232 CTTCCTGAAAAAGGGTACATGGG + Intergenic
948271104 2:236673937-236673959 ACACCTGCACCAGGGTACCTGGG + Intergenic
948765291 2:240216289-240216311 ACCCAAGAAAAAGGGTACATAGG + Intergenic
948922056 2:241070482-241070504 TCACCTGAAAACGGGTGCCGAGG + Intronic
1170919685 20:20665902-20665924 ACCAGTGAAAAAGGGTACCTTGG + Intronic
1171045578 20:21807110-21807132 ACATCTGAAACATGGTACATGGG + Intergenic
1181485580 22:23229757-23229779 ACACCTGAAAGGGGGGACATGGG - Intronic
1185238016 22:49725772-49725794 ACACCTGAAAACCGGAACCCGGG + Intergenic
952889381 3:38030312-38030334 CCACCTGAAGAAGGGACCCTGGG - Intergenic
955882058 3:63557267-63557289 AAACCTCTAAGAGGGTACCTAGG + Intronic
957145968 3:76423961-76423983 ACAACTGGAAAAGGGGACTTTGG + Intronic
957363007 3:79183310-79183332 ACACCTGAAAGAGGGAACTCTGG + Intronic
959335719 3:105062516-105062538 TCACCTAAAAAAGAGTATCTGGG + Intergenic
959408877 3:105996206-105996228 TCATCTGACAAAGGGTCCCTTGG + Intergenic
962127741 3:132640069-132640091 ACCCCTGAAAAAGGGAATATGGG + Intronic
962587991 3:136861753-136861775 AGACCTGAAAATTGGGACCTGGG - Intergenic
962877438 3:139546432-139546454 GCAAGTGAAAAAGGGTATCTTGG + Intergenic
964657152 3:159080300-159080322 ACACCTTAAAAAGGGTATGTGGG - Intronic
972145196 4:36015495-36015517 ACATCTGAATAAGGTCACCTTGG - Intronic
972707762 4:41562083-41562105 ACACCTGAAAAAGGGTACCTTGG - Intronic
976380297 4:84391125-84391147 ACACCTGAAAATGGGAATATTGG - Intergenic
982918701 4:161247992-161248014 ACACCAGAAAGAGAGGACCTTGG + Intergenic
983680091 4:170343563-170343585 ACACCTGAAAAAAGGAACTGAGG - Intergenic
986027195 5:3862073-3862095 ACACCTGGAGAAGCCTACCTTGG + Intergenic
989126223 5:38054721-38054743 AAACCTGAAAAAGGGATCATGGG + Intergenic
989992298 5:50781773-50781795 AGACCTGAAACAGAGTAGCTAGG - Intronic
993135276 5:83953029-83953051 ACAGCTGAAGCAGGGTGCCTAGG + Intronic
994119694 5:96100151-96100173 AAACCTGCAGCAGGGTACCTGGG - Intergenic
995104017 5:108352925-108352947 ACACCAAAAAGATGGTACCTTGG + Intronic
998228216 5:140342988-140343010 CCACCAGAAAGAGGGAACCTCGG + Intronic
999711170 5:154319899-154319921 ACAGCAGACAAAGGGGACCTGGG - Intronic
1000100808 5:158014404-158014426 ACCCCTGAAATAGGCTTCCTTGG - Intergenic
1008417066 6:51254183-51254205 TCACCTCAAAAATGGTACATTGG - Intergenic
1012551599 6:100468658-100468680 ACAACTGAAAAGCAGTACCTAGG - Intergenic
1013990495 6:116249815-116249837 TCACCTGAAAAATGGTAAATGGG - Intergenic
1014106084 6:117563336-117563358 ACACATGAAAATGGAGACCTGGG - Exonic
1014169923 6:118267297-118267319 ACACCTGAAACAGGGCACACAGG + Intronic
1022974505 7:35545113-35545135 CCAACAGAAAAAGGCTACCTGGG + Intergenic
1023403411 7:39807253-39807275 ACAGCTGAAAGGGGGTACGTGGG - Intergenic
1026245193 7:68613397-68613419 CCAACAGAAAAAGGCTACCTGGG + Intergenic
1027541851 7:79476895-79476917 AGACCTGAAACAGGGTAATTTGG + Intergenic
1027642556 7:80755277-80755299 ACATCTTAGAAAGGATACCTGGG + Intronic
1033971763 7:147049680-147049702 ACTCCTGAAAGGGTGTACCTGGG + Intronic
1034535901 7:151725503-151725525 ACACCTAAAGATGGGTACATTGG + Intronic
1035430606 7:158817568-158817590 ACACCTGGAAGTGGGTACATTGG - Intronic
1036008153 8:4691058-4691080 GCACCTTTAAAATGGTACCTGGG + Intronic
1036613221 8:10367800-10367822 ACATCTGGAAGAGGGTAACTGGG + Intronic
1037076196 8:14721967-14721989 ACACCTGAGAGAGGGTATTTAGG - Intronic
1037903883 8:22703961-22703983 ACACCTGGAAGAGGGTACACCGG - Intergenic
1040335558 8:46414237-46414259 ATACCTGCAAAAGGGTAACCAGG + Intergenic
1041659713 8:60389867-60389889 ACTCCTGAAAAAGGTTCCTTTGG - Intergenic
1042491059 8:69398362-69398384 ACGGCTGAAGGAGGGTACCTAGG + Intergenic
1042747956 8:72127874-72127896 CCAACAGAAAAAGGCTACCTGGG + Intergenic
1045821442 8:106343088-106343110 AGACCTGAAAGAAGGTAGCTGGG - Intronic
1050847919 9:10246662-10246684 AAACCTCAAAAAGTGTACTTAGG - Intronic
1052823029 9:33154344-33154366 CAACCTGATAAAGGGCACCTAGG + Intronic
1053086613 9:35229271-35229293 AAACCTGAAAAACTGGACCTTGG + Intronic
1053286262 9:36851339-36851361 ACAACTGAAAATGGGAACTTGGG - Intronic
1053666827 9:40322983-40323005 ACACTTGAAAAGCGGGACCTGGG - Intronic
1053916422 9:42948090-42948112 ACACTTGAAAAGCGGGACCTGGG - Intergenic
1054377979 9:64463011-64463033 ACACTTGAAAAGCGGGACCTGGG - Intergenic
1054517782 9:66053300-66053322 ACACTTGAAAAGCGGGACCTGGG + Intergenic
1058637031 9:107047286-107047308 ACGCTTGGAAAAGGCTACCTTGG - Intergenic
1059988646 9:119843740-119843762 AAACCTAACAAAGGGTACCCGGG + Intergenic
1189050978 X:37645241-37645263 ACAACTGTGAAATGGTACCTGGG + Intronic
1189750740 X:44218936-44218958 TCCCCTGCCAAAGGGTACCTGGG - Intronic
1194672419 X:96750925-96750947 ACAACTGACAAAAGGTACCATGG - Intronic
1197170240 X:123425941-123425963 AGGCCAGAAAAAGGTTACCTTGG + Intronic
1199412360 X:147538745-147538767 ACACCTAAAAATTGGTACTTAGG + Intergenic
1199596650 X:149511210-149511232 ACACCTGTGAGAGGGGACCTTGG - Intronic