ID: 972716880

View in Genome Browser
Species Human (GRCh38)
Location 4:41655397-41655419
Sequence TCATGCAACAAGTGGGAGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 97}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972716877_972716880 0 Left 972716877 4:41655374-41655396 CCACTCAGCTATCTTTAATATTG 0: 1
1: 0
2: 2
3: 23
4: 246
Right 972716880 4:41655397-41655419 TCATGCAACAAGTGGGAGTAAGG 0: 1
1: 0
2: 1
3: 4
4: 97
972716876_972716880 9 Left 972716876 4:41655365-41655387 CCACAGGTGCCACTCAGCTATCT 0: 1
1: 0
2: 1
3: 14
4: 143
Right 972716880 4:41655397-41655419 TCATGCAACAAGTGGGAGTAAGG 0: 1
1: 0
2: 1
3: 4
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972716880 Original CRISPR TCATGCAACAAGTGGGAGTA AGG Intronic
901356924 1:8658346-8658368 TCATGCAACTAGGGTGAGAAAGG + Intronic
902993270 1:20204508-20204530 TCATGCAGAAAGTGGCAGTGGGG + Intergenic
907586350 1:55621186-55621208 TCACACAACATGTGGGATTATGG - Intergenic
908610618 1:65856112-65856134 TCATCCATCAAGTGGTATTAGGG - Intronic
910057893 1:83053470-83053492 TCATGTAAGAAGTGGGAGACTGG - Intergenic
910066262 1:83155089-83155111 TCAAGCAAAAAATGGGTGTATGG - Intergenic
911690442 1:100827174-100827196 TCATTGAAAAAGAGGGAGTAGGG - Intergenic
918149171 1:181783260-181783282 TCATGGGACAAGTGGAAATATGG + Intronic
923548799 1:234944826-234944848 TCATCCATAAAGTGGGAGTCAGG - Intergenic
1066184747 10:32998280-32998302 TCTTTTAAAAAGTGGGAGTAGGG - Intronic
1070436508 10:76398836-76398858 TACTGCATCAAGTGGGAATAAGG - Intronic
1072790245 10:98312524-98312546 CCATGCCACAAGTGGGAAGAGGG - Intergenic
1074223752 10:111463032-111463054 TCCTACAACATGTGGGAGTTGGG - Intergenic
1079132338 11:17754544-17754566 TTATGCAACTAGAGGGAGTGAGG + Intronic
1081830524 11:46108439-46108461 TCATGTGGGAAGTGGGAGTAAGG - Intronic
1083160216 11:60849919-60849941 TCCTGGAACATGTGGGAGAAGGG - Exonic
1088104563 11:106191733-106191755 TCATGCAACAAGTTGTATTGGGG - Intergenic
1089379331 11:118016228-118016250 TCATGCACCCAGTGGCAGCAGGG + Intergenic
1093114005 12:15187208-15187230 CAAGGCAACAAGTAGGAGTAAGG + Intronic
1099001687 12:77185606-77185628 GCAGGCAAGAAGTGGGAATATGG - Intergenic
1101397156 12:104358448-104358470 TCATCTAAAAAGTGGGTGTAGGG - Intergenic
1109029475 13:57174706-57174728 GGATGCAACAAGTGTCAGTAAGG + Intergenic
1115634533 14:35278726-35278748 TCAAGCAACAAGTCTGAGTGAGG - Intronic
1117671207 14:58107866-58107888 TCATGGGAGAAGTGGGAGAAAGG - Intronic
1121027838 14:90629644-90629666 TCATTCAACAATTCAGAGTATGG - Intronic
1123633296 15:22276898-22276920 TCATGCAACTAGGGCGAGAAAGG - Intergenic
1128882570 15:71257074-71257096 TCCTGCTACAAGGGGTAGTATGG + Intronic
1131536327 15:93240888-93240910 TCATGCAGCAGATGGAAGTAAGG - Intergenic
1132362193 15:101225614-101225636 ACATGGCACAAGTGGGAGCAAGG - Intronic
1135339331 16:21632844-21632866 TCATCCCACAAGTCTGAGTAAGG + Intronic
1138388472 16:56652624-56652646 TCCTGCAAGAAGTGTGAGTGTGG + Exonic
1149207203 17:54262001-54262023 ACATGCAGGAAGTGGAAGTAGGG + Intergenic
1151464027 17:74273013-74273035 TCATCCAAGAAGTGGGATTGGGG - Intergenic
1155507206 18:26546067-26546089 TCAGGCTACAAATTGGAGTATGG - Intronic
1157565305 18:48675588-48675610 CCCTGCAGCAAGTGGGAGGATGG + Intronic
1164581299 19:29437024-29437046 TTATGCAACTAGTGGGAGAGTGG + Intergenic
1166002709 19:39887352-39887374 TCATCTATCAAGTGGGAATAAGG + Intronic
1166005495 19:39903604-39903626 TCATCTATCAAGTGGGAATAAGG + Intronic
1168423283 19:56218994-56219016 TCATTCAAGAAGTGGAGGTAGGG - Intergenic
927667717 2:25043614-25043636 TCTTGGACCAAGTGGGAGGAGGG + Intronic
932023054 2:68107657-68107679 AGATGCAACAGGTTGGAGTATGG - Intronic
933740305 2:85528480-85528502 TTATGCACCAAATGGGAGAAGGG - Intergenic
936855368 2:116951757-116951779 TCATGCAGGAACTGAGAGTAGGG + Intergenic
940589985 2:155710931-155710953 TCATGAAAGAAGTGAAAGTATGG + Intergenic
941214484 2:162688803-162688825 TCATTTAACAGGTGGGTGTATGG + Intronic
941474029 2:165926227-165926249 TCATGCATTAAGTGGTAGTTGGG - Intronic
942682749 2:178495067-178495089 TCAAGGAAGAAGTGGGAGAATGG + Intronic
944449694 2:199828849-199828871 TAAACCAACAAATGGGAGTAAGG + Intronic
946297323 2:218795387-218795409 TCCTGCAACAAGGGAGAGAAAGG + Intronic
1170787445 20:19479780-19479802 TCATCCAACATGTGGGACAATGG - Intronic
1174123688 20:48287238-48287260 TCAAGCAACAAGAGAGAGCAGGG - Intergenic
1175853316 20:62105272-62105294 TCCTGGAAGAGGTGGGAGTACGG + Intergenic
1176657108 21:9596975-9596997 TCATGCACCAGGTTGGAGAATGG + Intergenic
1177849548 21:26330225-26330247 TCAGGCAACATTTGGTAGTAGGG - Intergenic
1178637151 21:34314114-34314136 TTATGCAACAAGTGAGAGGAAGG - Intergenic
1178675397 21:34627201-34627223 TCATGTAACAAATGGGACTTGGG - Intergenic
1178727384 21:35065932-35065954 CCATTCAACAAGTGAGAGAAAGG - Intronic
1180763994 22:18232720-18232742 TCATGCAACAACTGACAGAAGGG - Intergenic
1180771650 22:18391822-18391844 TCATGCAACAACTGACAGAAGGG + Intergenic
1180803027 22:18641436-18641458 TCATGCAACAACTGACAGAAGGG + Intergenic
1181218688 22:21353824-21353846 TCATGCAACAACTGACAGAAGGG - Intergenic
1184598593 22:45529101-45529123 TCACCCAAGAAGTGGGAGCAAGG - Intronic
1203233487 22_KI270731v1_random:132813-132835 TCATGCAACAACTGACAGAAGGG + Intergenic
950740056 3:15043654-15043676 TCATGCAGTAAGTGGGAGTGTGG + Exonic
953932955 3:47015528-47015550 TGATCCAACAAGTGGGAGAGAGG + Intergenic
955635066 3:61019399-61019421 GCATGCAACAGGTGGGAGTAAGG + Intronic
972347996 4:38209849-38209871 TGTTGCAACAATTGGGATTAGGG + Intergenic
972716880 4:41655397-41655419 TCATGCAACAAGTGGGAGTAAGG + Intronic
975065174 4:70052850-70052872 TCCAGCTACAAGTGGGACTAGGG + Intronic
975789382 4:77932297-77932319 TCATGCACCAGCTGGGAGAAAGG - Intronic
976411872 4:84722461-84722483 TCATTTCACAAGTGGCAGTATGG + Intronic
983135247 4:164070896-164070918 TCATGCAAACAGTAGGAGAAGGG - Intronic
984817323 4:183850791-183850813 TCATGTGACAAATGGGAGAAAGG + Intergenic
985418316 4:189759156-189759178 TCATGCACCAGGTTGGAGAATGG - Intergenic
990058535 5:51617357-51617379 TCATTCAATAAATGGGAGAAAGG - Intergenic
993297322 5:86157961-86157983 TAATGCAAGAAGTGAGAGAATGG - Intergenic
995389017 5:111618649-111618671 TCTGGCAATAAGTGGCAGTAAGG + Intergenic
997103197 5:130990930-130990952 TCTTGCCTCAAGTGGGAGTTTGG - Intergenic
997780998 5:136658454-136658476 TGCTTCAACCAGTGGGAGTATGG - Intergenic
998771946 5:145555848-145555870 TCATGGAAGCAGTGGCAGTAGGG - Intronic
1008830568 6:55755798-55755820 TCATGGAATAAATGGGAGAAGGG - Intronic
1010968628 6:82240761-82240783 TCAAGCACCAAGGGGGAGTGAGG + Exonic
1013362827 6:109410536-109410558 CCATTCAACAAGTAGGAGTTTGG - Intronic
1013440715 6:110164469-110164491 TCATGCATCATGTGTCAGTAGGG + Intronic
1015899861 6:138053306-138053328 TCATTCATCAGGTGGGAGCAGGG - Intergenic
1027277853 7:76579672-76579694 TCAAGCAAAAAATGGGTGTATGG + Intergenic
1028728346 7:94115449-94115471 TCATCAAACAAGTGGGACTAAGG + Intergenic
1028961227 7:96751517-96751539 TCCTTCCAGAAGTGGGAGTAAGG - Intergenic
1030252436 7:107462658-107462680 TCATCCTACAAGTGGAAGCAGGG + Intronic
1035022553 7:155808079-155808101 ACATGCAACAACTGGGGGTGGGG + Intronic
1036961299 8:13247630-13247652 TCATGCGACAATTGAGAGCATGG - Intronic
1037832367 8:22197027-22197049 ACATGTAGCAAGTGGGAGGAAGG + Intronic
1039369241 8:36967963-36967985 TCATCCATAAAATGGGAGTAAGG - Intergenic
1039604120 8:38866835-38866857 TCATGAAACAGGTTGCAGTAAGG + Intergenic
1041843185 8:62295411-62295433 TCATGCAACAACTTGGAGTTTGG + Intronic
1050149750 9:2607761-2607783 GCATGTAACAGGTGGGAGTTTGG - Intergenic
1058116696 9:101092594-101092616 TCCTGCAGCACGAGGGAGTAAGG - Intronic
1203634831 Un_KI270750v1:100549-100571 TCATGCACCAGGTTGGAGAATGG + Intergenic
1188105207 X:26140914-26140936 ACAAGTAACAAGAGGGAGTAAGG + Intergenic
1188545975 X:31307829-31307851 TCTTGAAAAAAGTTGGAGTAAGG - Intronic
1195581542 X:106509617-106509639 TCATAGAACAAGTGGCAGGAAGG + Intergenic
1197181879 X:123545260-123545282 TTATGCTACAAGATGGAGTAAGG + Intergenic
1199480774 X:148296525-148296547 TCCTACAACATGTGGGAATATGG - Intergenic