ID: 972718501

View in Genome Browser
Species Human (GRCh38)
Location 4:41673186-41673208
Sequence GCTCAGTCCCAAGCCAATAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 81}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972718491_972718501 25 Left 972718491 4:41673138-41673160 CCCTTGATGTCCCCAGCCACAGT 0: 1
1: 1
2: 1
3: 11
4: 158
Right 972718501 4:41673186-41673208 GCTCAGTCCCAAGCCAATACTGG 0: 1
1: 0
2: 0
3: 5
4: 81
972718493_972718501 15 Left 972718493 4:41673148-41673170 CCCCAGCCACAGTACAAAACTAG 0: 1
1: 0
2: 0
3: 20
4: 140
Right 972718501 4:41673186-41673208 GCTCAGTCCCAAGCCAATACTGG 0: 1
1: 0
2: 0
3: 5
4: 81
972718496_972718501 13 Left 972718496 4:41673150-41673172 CCAGCCACAGTACAAAACTAGGG 0: 1
1: 0
2: 0
3: 4
4: 76
Right 972718501 4:41673186-41673208 GCTCAGTCCCAAGCCAATACTGG 0: 1
1: 0
2: 0
3: 5
4: 81
972718498_972718501 9 Left 972718498 4:41673154-41673176 CCACAGTACAAAACTAGGGACTA 0: 1
1: 0
2: 0
3: 8
4: 84
Right 972718501 4:41673186-41673208 GCTCAGTCCCAAGCCAATACTGG 0: 1
1: 0
2: 0
3: 5
4: 81
972718494_972718501 14 Left 972718494 4:41673149-41673171 CCCAGCCACAGTACAAAACTAGG 0: 1
1: 0
2: 0
3: 6
4: 118
Right 972718501 4:41673186-41673208 GCTCAGTCCCAAGCCAATACTGG 0: 1
1: 0
2: 0
3: 5
4: 81
972718492_972718501 24 Left 972718492 4:41673139-41673161 CCTTGATGTCCCCAGCCACAGTA 0: 1
1: 0
2: 2
3: 20
4: 167
Right 972718501 4:41673186-41673208 GCTCAGTCCCAAGCCAATACTGG 0: 1
1: 0
2: 0
3: 5
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972718501 Original CRISPR GCTCAGTCCCAAGCCAATAC TGG Intronic
900928240 1:5719416-5719438 GCACAAACCAAAGCCAATACAGG + Intergenic
906482542 1:46208984-46209006 GCTCAGTCCCGAGCCAGCAGTGG + Intronic
909040876 1:70649913-70649935 GCCCAGTTCCAAGCCAACAGAGG + Intergenic
909873760 1:80778416-80778438 GCTCCATCCCAAGGAAATACAGG - Intergenic
915687463 1:157648961-157648983 GCTCAGTGCCCACCCAATCCAGG + Intergenic
917416360 1:174814493-174814515 GCACAATCCCAGCCCAATACTGG - Intronic
919980166 1:202637932-202637954 GCTCATTCCCAAGAGAATAAGGG + Intronic
924246798 1:242093226-242093248 GCTCAGTGCCAGGTAAATACAGG + Intronic
1063462855 10:6225475-6225497 GCTCAGGCCCAATCCCATAGCGG - Intronic
1074285572 10:112094474-112094496 TCTCAGTCCTAAGCCCATAAAGG - Intergenic
1075933730 10:126322322-126322344 GCTCCGTCCAAGGCCAAGACGGG + Intronic
1077523528 11:3050366-3050388 GCACACTCCCTAGCCAAAACTGG + Intronic
1080316685 11:30957840-30957862 GCTCAGGCTCAAGCAAATCCAGG + Intronic
1084304307 11:68271791-68271813 TCTCAGTCCCAAGCCAGTCAGGG + Intronic
1088905903 11:114155412-114155434 GCTCAGTCACGAGCCAGCACGGG - Intronic
1096384973 12:51189274-51189296 ACCCATTCCCAACCCAATACTGG - Exonic
1096762622 12:53855102-53855124 ACTCTGTCCAAAGCCAAGACTGG + Intergenic
1097717477 12:62982067-62982089 ACTAAGTCCCACCCCAATACTGG + Intergenic
1100125336 12:91417688-91417710 GTTTAGACCCAAGACAATACTGG - Intergenic
1101574783 12:105987370-105987392 GCCAAGTCCCAAGTCAATGCGGG + Intergenic
1104640372 12:130463218-130463240 GCCCAGTCCCAAACCCAGACAGG - Intronic
1112823052 13:103357980-103358002 GCTCAGTCCTAAGCCACATCTGG - Intergenic
1121442763 14:93959179-93959201 GCTCAGTCCCAGGCCCACTCTGG + Intronic
1122313571 14:100812614-100812636 GCTGAGTCCCAAGCCTATCATGG + Intergenic
1122313691 14:100813230-100813252 GCTGAGTCCCAAGCCTATCATGG - Intergenic
1127533263 15:59865492-59865514 GTTCAGTCCCCAGCCAAGACTGG - Intergenic
1128603437 15:69016506-69016528 GCTCTGCCCCAAGTCAATGCAGG + Intronic
1129799911 15:78405953-78405975 GCTCAGTCCCAACCCCACTCTGG - Intergenic
1131871033 15:96764824-96764846 GGCCAGTCCCAAGCCCGTACGGG - Intergenic
1131953220 15:97704244-97704266 GCTCAGTCCCAAGACTGAACTGG - Intergenic
1136473314 16:30496273-30496295 GCTTAGTCCCCAGCCAAGTCAGG + Exonic
1143845389 17:9769575-9769597 GCTCAGGCCGAAGCCAACAGAGG - Intergenic
1148197703 17:45726596-45726618 GCTCAGCACTTAGCCAATACAGG - Intergenic
1148873307 17:50671624-50671646 GCAGAGTCCCAAGGCCATACAGG + Intronic
1152368514 17:79870900-79870922 GCTCAGACCCAAGGCGCTACAGG + Intergenic
1155709441 18:28857881-28857903 GTTCAGTCCCAACACAATGCAGG - Intergenic
1163938703 19:20473829-20473851 GGTCTGACCCAAGCCAATAGAGG + Intergenic
935246661 2:101224830-101224852 GCTCTGTGCCCAGCCAATAAGGG - Intronic
941587559 2:167379705-167379727 GCTCAGTCCCAAGACACTGGAGG + Intergenic
942446659 2:176082855-176082877 GCTCAAACCCAAGCCAATAGGGG + Intronic
947834360 2:233164550-233164572 GCTCAGTCCTCAGCAAATAGGGG + Intronic
1170654708 20:18275834-18275856 GCTCAGTCTCAAGGTAATAAAGG - Intergenic
1173585944 20:44183377-44183399 GTTCAGTCCCCAGCCAGTGCCGG + Intronic
1175466337 20:59193025-59193047 GCACAGTCCCCACCCAAGACAGG + Exonic
1175584202 20:60124855-60124877 GCTCAGTTCCAAGCCAGTGTGGG + Intergenic
1184875000 22:47268813-47268835 GCAGAGTCTCAAGCCAACACTGG + Intergenic
1185271411 22:49930882-49930904 ACTCTGTTCCAACCCAATACTGG - Intergenic
1185382172 22:50514567-50514589 GCCCACTCCCAAGACACTACTGG - Intronic
950933185 3:16811575-16811597 GCTCTGTCCAAGGCCAATAAAGG + Intronic
950948503 3:16975599-16975621 GCTCAGACACAGGCCCATACTGG + Intronic
954999975 3:54918659-54918681 GCTCAAACCCAAGCCAAGGCCGG - Exonic
964949765 3:162276155-162276177 GGCCAGTACCAAGCCAATAAAGG - Intergenic
967324611 3:188226684-188226706 ACTCAGTACAAAGCCAATGCTGG - Intronic
969096927 4:4740200-4740222 GCAGAGTCCCAAGGCAGTACAGG - Intergenic
972362124 4:38336348-38336370 GCAGAGTCCCAAGTCAATGCAGG - Intergenic
972718501 4:41673186-41673208 GCTCAGTCCCAAGCCAATACTGG + Intronic
973658450 4:53076495-53076517 ACTCATTCCCAAGCCACTCCGGG + Intronic
976479573 4:85524649-85524671 GCTTAGTCCAAAGCCTATACTGG + Intronic
978496427 4:109364456-109364478 GCTGATTCCAAAGCCAATGCTGG - Intergenic
982112090 4:152066005-152066027 GCTCAGTCCAAATCCAAGTCTGG - Intergenic
986984804 5:13488413-13488435 GGAGAGTCCCAAGCCAGTACGGG - Intergenic
988475676 5:31583234-31583256 TCCCAGTACCAAGCCAATATTGG + Intergenic
988860347 5:35270996-35271018 GCTCAGTGCCAAGCAAATGCTGG + Intergenic
996008810 5:118457486-118457508 GCTAAGTCCCAAGCCAACTGAGG + Intergenic
1001809286 5:174614966-174614988 GCTCATTCCCAAACCAATCATGG - Intergenic
1006845140 6:37056469-37056491 GCTCAGCCCCACGCCCATCCCGG - Intergenic
1007336048 6:41155876-41155898 CCTCAATCCCAAGCAAAAACGGG - Intergenic
1008453058 6:51675211-51675233 GCTCAATCCTCAGCCACTACTGG + Intronic
1010842288 6:80660480-80660502 GCACACTCACAAACCAATACAGG - Intergenic
1018217843 6:161547988-161548010 GCTCAGCCCCAAATCAAGACTGG + Intronic
1018938910 6:168295031-168295053 GCTGAGTCCCAAGCATATGCTGG + Intronic
1022866515 7:34427321-34427343 CCTCTGTCTCCAGCCAATACTGG + Intergenic
1024643299 7:51349629-51349651 GCTCATTCCCAGACCAATCCTGG + Intergenic
1031384410 7:121130204-121130226 GCTCAGTCCTGACCCAATACTGG + Exonic
1033065288 7:138147643-138147665 GCCCAGTTCCTAACCAATACCGG + Intergenic
1036592213 8:10179374-10179396 GCTCAGTCCCACCCCTTTACTGG - Intronic
1039829143 8:41199137-41199159 GCTCATTCTAAAGCTAATACAGG - Intergenic
1040433195 8:47364194-47364216 GGTCAGTTTCAAGCCTATACAGG - Intronic
1047277890 8:123419518-123419540 ACACAGTCCCAAACAAATACTGG - Intronic
1048997932 8:139805527-139805549 GCACAGTGCCAAGCCCACACTGG - Intronic
1186079878 X:5919502-5919524 GCCCAGTCCCTAACCAAAACTGG - Intronic
1190655052 X:52604319-52604341 GCTTAGACCCACACCAATACAGG + Intergenic
1195768626 X:108323996-108324018 GCTCTGTGCCAAGCCACTAAAGG - Intronic
1197444511 X:126533763-126533785 GCTCAGAGCCACTCCAATACAGG - Intergenic
1197530360 X:127616665-127616687 GCTCAGTGCCCAGCCCATAGAGG + Intergenic
1198962860 X:142201319-142201341 GCACAGTGCCAAGCATATACTGG + Intergenic
1201915062 Y:19172758-19172780 GGTAACTCCCAACCCAATACTGG + Intergenic