ID: 972719864

View in Genome Browser
Species Human (GRCh38)
Location 4:41685217-41685239
Sequence GTCTATACACATATTTACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 162}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972719862_972719864 -2 Left 972719862 4:41685196-41685218 CCTTAAATTTTTTAGCTTGTTGT 0: 1
1: 0
2: 2
3: 36
4: 476
Right 972719864 4:41685217-41685239 GTCTATACACATATTTACCTGGG 0: 1
1: 0
2: 0
3: 14
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972719864 Original CRISPR GTCTATACACATATTTACCT GGG Intronic
905235572 1:36543771-36543793 GTCTATGTACATGTTTTCCTGGG + Intergenic
905602106 1:39261801-39261823 GTGTATACATGTATATACCTAGG + Intronic
907082981 1:51641792-51641814 ATCTAAACAGATATTTATCTCGG - Intronic
907193816 1:52670141-52670163 GTGTATAAACATATTTTTCTAGG - Intergenic
909680663 1:78287882-78287904 CTCTATGAAGATATTTACCTTGG + Intergenic
913374677 1:118137839-118137861 GCCTATACCCATGTTTACTTTGG + Intronic
914789449 1:150864020-150864042 GGCTATACACCTACATACCTAGG - Intronic
918907660 1:190519099-190519121 GTGTATACACACATTATCCTAGG - Intergenic
922032788 1:221820096-221820118 TTCTAGAAACATATTTATCTAGG + Intergenic
922993930 1:229941070-229941092 GTCTATCCTCATATTTATTTGGG + Intergenic
1065205330 10:23351932-23351954 GTCTCTACACATATTTTTTTGGG + Intergenic
1065370742 10:24982652-24982674 ATCCATACACATACATACCTAGG - Exonic
1066627376 10:37420693-37420715 GTATATACACATATATATTTAGG - Intergenic
1066676838 10:37896948-37896970 GTCTATTCTCTTATTTACTTTGG - Intergenic
1067279954 10:44863788-44863810 GTCTTTGCACCTATTTCCCTAGG + Intergenic
1067907731 10:50311086-50311108 GTCCTTCCACATATTTCCCTGGG + Intronic
1068249285 10:54416122-54416144 GTGTATATATATATTTAGCTTGG - Intronic
1069611035 10:69772632-69772654 GTCTGTACCCACATTTCCCTTGG - Intergenic
1074579973 10:114710018-114710040 GTACACACACATATTTACTTGGG + Intergenic
1078263136 11:9730472-9730494 GTGCATACACACATATACCTTGG - Intronic
1079462844 11:20699326-20699348 GTGTATACATATATATACCTTGG - Intronic
1082077690 11:47987045-47987067 GTCTATACAAAAAATTAGCTGGG + Intronic
1083428193 11:62600378-62600400 GTCTTTACTCATATTTTCTTGGG - Intronic
1085360926 11:75886459-75886481 ATTTTTACACATATATACCTGGG - Intronic
1088589034 11:111386590-111386612 GTGTATATACATATTTTCCTTGG + Intronic
1091686363 12:2565574-2565596 GGCTACACACAGAATTACCTAGG - Intronic
1093668447 12:21842677-21842699 GTCTATCTACCTATTTACCTTGG + Intronic
1093869511 12:24270999-24271021 ATATATACACATATTTCTCTAGG + Intergenic
1094723977 12:33093378-33093400 CTCCATACAGATAATTACCTGGG + Intergenic
1098257235 12:68629145-68629167 GTCTCTACAAAAAATTACCTGGG - Intronic
1099116591 12:78633574-78633596 TTCTATATACATATTTTCCAAGG - Intergenic
1099932365 12:89089122-89089144 GTATATAATAATATTTACCTGGG + Intergenic
1100265960 12:92976599-92976621 TTCTATACATGTATTTTCCTAGG - Intergenic
1104174018 12:126311750-126311772 GGCTATACAAATATAAACCTAGG - Intergenic
1105642798 13:22283393-22283415 CTCTAAACAAATATTTACTTTGG - Intergenic
1107215688 13:37915870-37915892 GTCTGTAAACATATTTATATTGG + Intergenic
1107589634 13:41889300-41889322 GTTTATACTGATATTTACTTTGG + Intronic
1107741764 13:43457934-43457956 GAATACACACATATATACCTTGG - Intronic
1109081357 13:57905400-57905422 TTCTTGACACATGTTTACCTAGG + Intergenic
1109120810 13:58454118-58454140 GTCTAAACAAATAAGTACCTGGG + Intergenic
1109615094 13:64823485-64823507 GTCTCTTCACATATTTCCTTTGG - Intergenic
1111233824 13:85381627-85381649 GTCTGTAGATATATTTACCAAGG - Intergenic
1111243475 13:85505831-85505853 GTCTACACATATATGAACCTGGG + Intergenic
1112052800 13:95660459-95660481 GTCTATAGAAATATTTATCTTGG + Intergenic
1112251754 13:97787543-97787565 ACCTATAAACATATTTATCTGGG + Intergenic
1113009081 13:105742879-105742901 GCCTACACACATATTTTGCTTGG + Intergenic
1113060061 13:106313440-106313462 CTGCATACACATATATACCTAGG - Intergenic
1114396583 14:22368632-22368654 ATGTATACACATATATACCATGG + Intergenic
1117779674 14:59219567-59219589 GTCTACATACAAATTTACCATGG - Intronic
1118633474 14:67726665-67726687 GCCTATACACAAGTGTACCTGGG + Intronic
1118820976 14:69345746-69345768 GTGTATAAGCATATTTTCCTGGG + Intronic
1120589373 14:86357030-86357052 GTCTAGAAACATATTTTCCATGG - Intergenic
1123156300 14:106229997-106230019 GTATATTCATATATTTACCATGG + Intergenic
1124066820 15:26352700-26352722 GTCTCTACACATTTTTACATTGG + Intergenic
1131856300 15:96599688-96599710 CTCTATTTACAAATTTACCTTGG - Intergenic
1135528329 16:23231041-23231063 ATATATATACATATTTACATGGG - Intergenic
1140881563 16:79202768-79202790 GTATTTACATATATTTACATAGG + Intronic
1143689990 17:8553437-8553459 GTGTATGCACATATATACCCAGG - Intronic
1144432122 17:15202695-15202717 TTCTATACATATATTTTCCATGG - Intergenic
1147123128 17:38347847-38347869 ATATATATATATATTTACCTGGG - Intergenic
1149016374 17:51913335-51913357 GTCTAAAGACATATATGCCTAGG + Intronic
1149169056 17:53788188-53788210 GTTGATATAGATATTTACCTGGG + Intergenic
1159158440 18:64612997-64613019 GTCTATAGATACATTTCCCTTGG + Intergenic
1160083365 18:75752256-75752278 GTCTAGAAACATGTTTACATAGG - Intergenic
1160535940 18:79591696-79591718 GTATATACACATGCTTGCCTAGG + Intergenic
1161932227 19:7348807-7348829 GTCTATACACCCATGTGCCTGGG + Intergenic
1162160160 19:8706309-8706331 GTCTATACATATATATACCAAGG - Intergenic
1162160162 19:8706336-8706358 ATCTATACATATATATACCAAGG - Intergenic
1162160164 19:8706363-8706385 ATCTATACATATATATACCAAGG - Intergenic
929165186 2:38874970-38874992 CTCAGTACACAAATTTACCTGGG - Intronic
929709802 2:44255396-44255418 GTCTATTCAAATTTTTAACTGGG - Intergenic
930434998 2:51329562-51329584 GTCTACACACACTGTTACCTAGG + Intergenic
930557049 2:52910335-52910357 GTCTATTCAAATATTTTGCTCGG - Intergenic
930585763 2:53264958-53264980 TTCTATACTCAGATTTAACTAGG + Intergenic
931128634 2:59306192-59306214 GTCCATAAACATATCTATCTGGG + Intergenic
932193776 2:69765057-69765079 GTGTATACACATATATACAGTGG - Intronic
932664171 2:73683477-73683499 GTCCCTGCACATGTTTACCTTGG - Intergenic
934539892 2:95165336-95165358 GTTTGTACACATATTTGCGTTGG - Intronic
935227992 2:101070904-101070926 GTCAATATACATATTAAACTTGG + Intronic
943520170 2:188939350-188939372 GTTTATACACATTTATCCCTAGG + Intergenic
943992942 2:194720801-194720823 GTATATATATATATATACCTCGG + Intergenic
945561975 2:211350643-211350665 TTCTACACATATAATTACCTTGG - Intergenic
945875703 2:215275955-215275977 ATATATATACATATTTAACTGGG + Intergenic
946291180 2:218746624-218746646 CTCTTTACACATATTCAGCTTGG - Intronic
1169544506 20:6636897-6636919 GTGTGTACACATATTTTTCTGGG + Intergenic
1172411922 20:34730873-34730895 GTCTATACAAAAAATTAGCTGGG - Intronic
1173020187 20:39260527-39260549 GTCTATAGAGAGAGTTACCTGGG - Intergenic
1173180619 20:40803882-40803904 GTCTAGACACATGTAGACCTTGG - Intergenic
1177882623 21:26711985-26712007 GTATATACATATATATACCCTGG - Intergenic
1182328907 22:29536412-29536434 ATATATACACACATTGACCTGGG - Intronic
1183791611 22:40075306-40075328 GTATATACACATAGTTACAGAGG - Intronic
1184570387 22:45319977-45319999 GTCCATGCATATATTTTCCTAGG - Intronic
1185198174 22:49485606-49485628 GTCTAAGCACATATTTGCTTTGG + Intronic
949791994 3:7802665-7802687 GTCTAATCACATTTCTACCTGGG + Intergenic
951459790 3:22938786-22938808 GTCTATAAATATATATAACTGGG + Intergenic
952314104 3:32217768-32217790 TTCTAAAAACATATTTAGCTGGG - Intergenic
953210979 3:40875123-40875145 CTGTATAGGCATATTTACCTAGG + Intergenic
955641617 3:61091777-61091799 GTCTCTACAAAAATTTAGCTGGG + Intronic
964412633 3:156415086-156415108 GTCTAAGCACAAATTTATCTAGG + Intronic
965839795 3:172891611-172891633 GTCTATACACCTCTACACCTGGG + Intronic
967286137 3:187872427-187872449 GTTTATACTCAAAATTACCTTGG - Intergenic
969096843 4:4739453-4739475 TTTAATACACATATTTTCCTTGG - Intergenic
970334161 4:15016229-15016251 GTGTATACACATATGTAACTGGG + Intronic
971702079 4:29991071-29991093 GTCTATACAGATGTTTTCTTGGG - Intergenic
972719864 4:41685217-41685239 GTCTATACACATATTTACCTGGG + Intronic
972951559 4:44330677-44330699 GTTTATAGACATATTCACCGAGG - Intronic
975879724 4:78889729-78889751 GTATATACACACATACACCTGGG - Intronic
975897918 4:79117302-79117324 GTCTAACCACAAATTTACCAGGG - Intergenic
977549027 4:98420774-98420796 TTCTATACCCATTTTTACCTTGG + Intronic
977820613 4:101468298-101468320 GTCTATGCTTATATTTACCTTGG + Intronic
980089419 4:128426820-128426842 ATCTATACACATATTTGAGTAGG - Intergenic
981756270 4:148144363-148144385 GTCTCTACAAATAATTAGCTAGG - Intronic
982078145 4:151759769-151759791 GTATATACACAAAATTACTTGGG - Intronic
983559426 4:169086123-169086145 GTCTCTACAAAAAGTTACCTGGG + Intergenic
984079235 4:175223208-175223230 GTCTATGTAGATAGTTACCTAGG - Intergenic
986200894 5:5577337-5577359 GTCTGTTCACATATTGATCTGGG + Intergenic
987571509 5:19668053-19668075 GTCAGTATACATATTTACGTGGG + Intronic
988570369 5:32359024-32359046 GTCTCTACAAATAATTAGCTGGG + Intronic
991573924 5:68083157-68083179 GTCTATGGACATATTCTCCTGGG - Intergenic
991959166 5:72025061-72025083 TTCTATAAACATATTTAATTGGG + Intergenic
994152428 5:96463119-96463141 CTGTATACACATGTCTACCTGGG - Intergenic
995038023 5:107557183-107557205 GGCTGTAAACATATTTGCCTTGG + Intronic
995356777 5:111246713-111246735 GTCTGTACACTAATTGACCTAGG + Intronic
996171284 5:120294689-120294711 GTATCTACAAATAATTACCTGGG - Intergenic
999048048 5:148491061-148491083 GACTAAACACACATTTACATGGG + Intronic
1005087244 6:22019774-22019796 GTTTATTTACATATTTTCCTAGG + Intergenic
1005361768 6:25037446-25037468 GTCTATACTCCTCTTTACCTGGG + Intronic
1005876878 6:30017607-30017629 GTCCATACACAGGGTTACCTTGG - Intergenic
1006207946 6:32366149-32366171 ATCTCTACATATACTTACCTCGG + Exonic
1012015831 6:93849993-93850015 CTCTTTACACTTATGTACCTAGG + Intergenic
1012557222 6:100528852-100528874 ATCTATACTAACATTTACCTTGG + Intronic
1012746196 6:103092635-103092657 GTCTGACCACATATTTACCAGGG - Intergenic
1012895183 6:104939975-104939997 ATATATACACATATTTAGCTTGG - Intergenic
1012927302 6:105280729-105280751 GTCTCTACAAATAATTAGCTGGG - Intronic
1014601237 6:123415919-123415941 CTCAATAGACATATTTACCTAGG + Intronic
1015851629 6:137579821-137579843 GTCTATTCACATTTTTGGCTAGG + Intergenic
1018255857 6:161918202-161918224 ATCAATTCACATATTTACCATGG + Intronic
1020953620 7:14711465-14711487 TTGAACACACATATTTACCTTGG + Intronic
1024724687 7:52179036-52179058 TTCTATACATATATACACCTAGG - Intergenic
1024801545 7:53085989-53086011 GTCTGACCACAAATTTACCTAGG + Intergenic
1026063546 7:67048297-67048319 GTCCATTCACTTATTCACCTGGG + Intronic
1026714804 7:72779177-72779199 GTCCATTCACTTATTCACCTGGG - Intronic
1027454287 7:78368557-78368579 TTATATACACATATTTTTCTTGG - Intronic
1028552965 7:92092081-92092103 GTCTGGAGACATATTTACCCAGG - Intronic
1031304667 7:120111257-120111279 GTATATACATATATATACATGGG + Intergenic
1032065943 7:128770792-128770814 ATATATACATATATTTATCTTGG - Exonic
1034979011 7:155463951-155463973 GTAAACACACATATTTATCTTGG - Exonic
1036192863 8:6687050-6687072 ATATATACACATATATATCTGGG - Intergenic
1037612550 8:20488553-20488575 GTCTACAGATATATTTACTTTGG + Intergenic
1038244516 8:25842917-25842939 GTCTATACACAGACTTAGTTTGG - Exonic
1038763173 8:30403629-30403651 GTGTATACACAGATTTAGCTAGG - Intronic
1039215948 8:35271757-35271779 ATGTATACATATATTTACATAGG + Intronic
1040742506 8:50595555-50595577 ATTTATACACATAAGTACCTGGG + Intronic
1043228190 8:77761589-77761611 TTATATATATATATTTACCTTGG - Intergenic
1044922603 8:97181704-97181726 GTCTTTACAAATATTTAAGTTGG + Intergenic
1045180497 8:99776080-99776102 GTCCATACCCATATTTCCATAGG - Intronic
1046870413 8:119199286-119199308 ATATATACACATATATACATGGG - Intronic
1048522184 8:135166838-135166860 TTCTATACACACTTTTGCCTTGG - Intergenic
1048751501 8:137681902-137681924 TTCTATACAGATACTAACCTAGG + Intergenic
1052472751 9:28920776-28920798 TTCTATACACATACTTGTCTAGG + Intergenic
1052682535 9:31712056-31712078 GTATACACACATATTTATGTAGG - Intergenic
1053460159 9:38262518-38262540 GTCAATGCCCATCTTTACCTTGG + Intergenic
1058533772 9:105933619-105933641 GTCTAACCACAGATTTACCAGGG - Intergenic
1058932886 9:109739452-109739474 ATCTATACACCTATATACCAAGG - Intronic
1059232758 9:112736817-112736839 GTCTTTGCACATATTTCCTTAGG + Intergenic
1061102702 9:128504384-128504406 ATATATATATATATTTACCTAGG + Intergenic
1189015755 X:37094868-37094890 GTGTATACACAGATTTAGCTAGG - Intergenic
1189635677 X:43005858-43005880 GTCTAAACTGCTATTTACCTGGG + Intergenic
1190008936 X:46766495-46766517 GGATATATACATATATACCTAGG - Intergenic
1190298277 X:49041266-49041288 GTGTGTACACACATATACCTGGG - Intronic
1191170155 X:57437919-57437941 ATGTATACACATATATACATAGG + Intronic
1192470782 X:71396862-71396884 GTCTCTACAAAAATTTAGCTGGG + Intronic
1192818328 X:74616980-74617002 GGCTATAGAAATATTAACCTAGG - Intergenic
1195364822 X:104115721-104115743 ATCTATACATATATCTATCTGGG - Exonic
1196297068 X:114010160-114010182 GTTGATACATACATTTACCTAGG + Intergenic
1196662670 X:118283991-118284013 ATTTATACACATATATGCCTAGG + Intergenic
1199018177 X:142844484-142844506 GTATATACACATATACACATAGG + Intergenic