ID: 972720404

View in Genome Browser
Species Human (GRCh38)
Location 4:41691167-41691189
Sequence GTGGGGAATAAATCCAAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 233}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972720404_972720407 -7 Left 972720404 4:41691167-41691189 CCCCTCTTGGATTTATTCCCCAC 0: 1
1: 0
2: 0
3: 16
4: 233
Right 972720407 4:41691183-41691205 TCCCCACTCTTGCAATGTAGAGG 0: 1
1: 0
2: 1
3: 6
4: 79
972720404_972720411 13 Left 972720404 4:41691167-41691189 CCCCTCTTGGATTTATTCCCCAC 0: 1
1: 0
2: 0
3: 16
4: 233
Right 972720411 4:41691203-41691225 AGGCAGCTTATGACATAATTTGG 0: 1
1: 0
2: 0
3: 10
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972720404 Original CRISPR GTGGGGAATAAATCCAAGAG GGG (reversed) Intronic
900828120 1:4942811-4942833 TTGGAGAATAAACCTAAGAGGGG + Intergenic
900940242 1:5793744-5793766 GTGGGGATTAAAGGCAAGAAAGG + Intergenic
901162403 1:7188811-7188833 TTGGGGTATATATCCAAAAGTGG + Intronic
905174815 1:36128552-36128574 GAGGGAACTAAATCCCAGAGAGG - Intergenic
905364250 1:37440257-37440279 GTTGAGAATAAATTGAAGAGGGG - Intergenic
905533475 1:38700432-38700454 CTGGGGAATAAACCCAAGGCTGG - Intergenic
906012747 1:42544199-42544221 GTGGGGAATGATTCTAAGAAAGG - Intronic
906636050 1:47411482-47411504 GTGGGGAATGCATCCCAGAAGGG - Intergenic
906665848 1:47621493-47621515 ACTGGGAATAGATCCAAGAGGGG + Intergenic
907209851 1:52811405-52811427 CTGGGGAAAAAAGCCAATAGTGG - Intronic
909464340 1:75956566-75956588 GTGGGTTAGGAATCCAAGAGTGG + Intergenic
910289779 1:85588849-85588871 GTGGAGTATAATACCAAGAGGGG + Intergenic
911976433 1:104502688-104502710 TTGGAGAATAAATCTGAGAGGGG + Intergenic
915792800 1:158693363-158693385 GTAGGAAATAAAGCCAAGTGTGG + Intergenic
919122477 1:193358439-193358461 GTCAGAAATAAAGCCAAGAGAGG - Intergenic
919187906 1:194178375-194178397 GTGGGAAATAAATCCAACAAGGG + Intergenic
919717408 1:200793246-200793268 GTGAGGATTAAATACAATAGTGG + Intronic
923169388 1:231399560-231399582 GAGGAGAATAAAGCCAACAGGGG + Intronic
923263500 1:232289889-232289911 GTGGGGAACAGAGCCCAGAGGGG - Intergenic
1065913749 10:30334188-30334210 GTGGAGAAAAAAATCAAGAGCGG + Intronic
1066246564 10:33589218-33589240 TTGGGGAATAAACCTGAGAGGGG + Intergenic
1070637905 10:78143880-78143902 GTGGGGAATGGATCTAACAGTGG + Intergenic
1070777874 10:79120582-79120604 ATGGGGAATGAGTCCTAGAGCGG - Intronic
1071436510 10:85652735-85652757 CTGGGGAAGAAACCCAGGAGAGG - Intronic
1073086408 10:100892606-100892628 GTTGGGTATACACCCAAGAGTGG + Intergenic
1074927546 10:118088630-118088652 GTCTGAGATAAATCCAAGAGGGG + Intergenic
1074990677 10:118703954-118703976 GTGGGGAAAAAATGCAAAATTGG - Intronic
1076452274 10:130565010-130565032 GTGGGAATGAAAACCAAGAGAGG - Intergenic
1076765421 10:132630553-132630575 GAGGGGAAGACATCCATGAGAGG + Intronic
1076765433 10:132630604-132630626 GAGGGGAAGACATCCATGAGGGG + Intronic
1076765437 10:132630621-132630643 GAGGGGAAGACATCCATGAGGGG + Intronic
1076765441 10:132630638-132630660 GAGGGGAAGACATCCATGAGGGG + Intronic
1076765445 10:132630655-132630677 GAGGGGAAGACATCCATGAGGGG + Intronic
1078096897 11:8304090-8304112 ATGGGGAAAAAGTCCATGAGAGG + Intergenic
1078758457 11:14233206-14233228 GTGAGGTATAAAACAAAGAGGGG - Intronic
1079312507 11:19379013-19379035 CTGGGGAAGAGATTCAAGAGAGG - Intronic
1080451919 11:32384917-32384939 CAGGGGAATCAATCCATGAGGGG - Intergenic
1080689533 11:34544944-34544966 GTGGGGTATAAGACAAAGAGAGG + Intergenic
1081227057 11:40537087-40537109 GGGGGGAATTAATGCAAGTGAGG + Intronic
1081810236 11:45910288-45910310 GTGGGCAAGTAATCCATGAGCGG + Intronic
1083706590 11:64520639-64520661 GTGGGGGATAAGCCCTAGAGTGG - Intergenic
1084640233 11:70421427-70421449 GTGGGGAAAACAACCAAAAGAGG - Intronic
1084993319 11:72949879-72949901 CTTGGGTATAAATCTAAGAGTGG + Intronic
1087525109 11:99299009-99299031 TTGGAGAATAAACCCAAGAGGGG - Intronic
1089178321 11:116564004-116564026 GTGGGGAAATGATCCAAGACAGG - Intergenic
1090685931 11:129119649-129119671 GAGGGAAATAAAACAAAGAGAGG + Intronic
1093531927 12:20175491-20175513 GTGGGGAAGACAACCAATAGAGG + Intergenic
1094201004 12:27794408-27794430 ATGGGGCCTAAATCCAACAGTGG - Intronic
1098135870 12:67401328-67401350 CTGGGGAAGACAGCCAAGAGAGG - Intergenic
1100068849 12:90685514-90685536 GTGGGGTATAGAACAAAGAGGGG + Intergenic
1100287204 12:93178261-93178283 TTGGAGAATAAACCCGAGAGGGG - Intergenic
1100379677 12:94049836-94049858 GTGTGGCAAAAAGCCAAGAGTGG - Intergenic
1104053869 12:125214726-125214748 GTGGAGAATAAATCTGGGAGAGG - Intronic
1106291099 13:28362994-28363016 AAGGGAAATAAATGCAAGAGTGG - Intronic
1106470053 13:30046352-30046374 ATGAACAATAAATCCAAGAGTGG + Intergenic
1107884077 13:44859641-44859663 GTGGGGGATAAATACTACAGTGG + Intergenic
1109595611 13:64549729-64549751 GTGGAGAATAAACCTGAGAGGGG - Intergenic
1113898168 13:113778949-113778971 TTGGAGAATAAACCCTAGAGGGG + Intronic
1115565060 14:34618152-34618174 GTAGGGAATAAATTTATGAGGGG - Intronic
1118106506 14:62666117-62666139 GTGGGGATAAAATCCAGGACAGG + Intergenic
1119043303 14:71295277-71295299 GTGGGTCAGGAATCCAAGAGTGG + Intergenic
1119998317 14:79277382-79277404 CTGGGGACTAAATCAAGGAGTGG + Intronic
1120032140 14:79653957-79653979 CTGGGGTATAAAACCCAGAGTGG - Intronic
1202905101 14_GL000194v1_random:66937-66959 CTGGGGTATATATCCAACAGTGG + Intergenic
1124881407 15:33646078-33646100 GTGGAGAATAAATGCCAGAGGGG - Intronic
1125790588 15:42362548-42362570 GTGGGCATTTTATCCAAGAGTGG - Intronic
1126727295 15:51644767-51644789 CTGGAAAATCAATCCAAGAGGGG + Intergenic
1127435808 15:58957197-58957219 GTGGGTAATAAGTTCAGGAGGGG + Intronic
1128728689 15:70006409-70006431 GTGGGGCATAAATGCAAGGAGGG - Intergenic
1128728695 15:70006431-70006453 GTGGGGCATAAATGCAAGGAGGG - Intergenic
1128728701 15:70006453-70006475 GTGGGGCATAAATGCAAGGAGGG - Intergenic
1131798219 15:96042402-96042424 TTGGGGAATATACCCAGGAGTGG - Intergenic
1132746069 16:1436830-1436852 GTGAGGGACAAAGCCAAGAGAGG + Intronic
1132900806 16:2253128-2253150 GTGTTGAATAAACCCAAGATCGG - Exonic
1133272930 16:4619466-4619488 CTGTGGAATAAATCAAAGAATGG - Intronic
1134567690 16:15265468-15265490 CTGGGGTATAAATCCAGGAGGGG + Intergenic
1134734747 16:16490885-16490907 CTGGGGTATAAATCCAGGAGGGG - Intergenic
1134932726 16:18221021-18221043 CTGGGGTATAAATCCAGGAGGGG + Intergenic
1135107837 16:19666225-19666247 GTGGGGTATTACTCAAAGAGGGG + Intronic
1135519129 16:23160063-23160085 TTGGAGAATAAACCTAAGAGGGG + Intergenic
1135747217 16:25027451-25027473 GTGGGGAATGGATTCAAGGGAGG - Intergenic
1138272660 16:55707141-55707163 GTTGGGAAGATATCCCAGAGAGG + Intergenic
1138950862 16:61911133-61911155 TAGGTGAATAACTCCAAGAGTGG + Intronic
1139007418 16:62590117-62590139 GTGGGGATTAAAGACAAGTGGGG + Intergenic
1139238410 16:65364470-65364492 GTCTGGAATAAATCCTACAGAGG - Intergenic
1139911078 16:70398111-70398133 GGGGGCCAGAAATCCAAGAGGGG + Intronic
1144305208 17:13963710-13963732 GTGGTCAATAAATCTAACAGAGG - Intergenic
1144537868 17:16109143-16109165 GTGGTGAGTAATTCCAAAAGTGG - Intronic
1144764584 17:17725520-17725542 GCGGGGACTCAATCCAAGGGGGG + Intronic
1145258529 17:21341106-21341128 GTGGGGAATAAACTCTAAAGGGG + Intergenic
1145318096 17:21746899-21746921 GTGGGGAATAAACTCTAAAGGGG - Intergenic
1146087880 17:29847149-29847171 GGGGGGAAAAATTCCAAGAGCGG + Intronic
1146181678 17:30702472-30702494 GCGGGGAATAATTCCAACTGTGG + Intergenic
1146698158 17:34928157-34928179 CTGGGGAAAAAAGCTAAGAGTGG - Intronic
1148679517 17:49465701-49465723 GTGGGGAATAAAAGCAGGACAGG + Intronic
1148915423 17:50972920-50972942 GTTGGGTATAAATCTAAAAGTGG - Intronic
1150177212 17:63071202-63071224 GTGGGGAATAGATGCATGATAGG + Intronic
1151011674 17:70505474-70505496 GTGGGTCCTAAATCCAAGACTGG + Intergenic
1151038764 17:70833074-70833096 GTGAGGAATAGAACCAACAGTGG - Intergenic
1156459072 18:37311323-37311345 GTGGGGAAGAGTTCCCAGAGAGG - Intronic
1158169804 18:54585045-54585067 GAGAGGAATGAATCAAAGAGGGG + Intergenic
1158864496 18:61624974-61624996 TTGGAGAATAAACCCGAGAGGGG - Intergenic
1160478306 18:79214749-79214771 GTGAGGCATAAATCCATGTGAGG - Intronic
1162977155 19:14213333-14213355 GCGGGGAATAATTCCAACTGTGG - Intergenic
1167359257 19:49021147-49021169 GTGAGAAAGAAATACAAGAGAGG + Intergenic
925382722 2:3438196-3438218 GTGGGGGATGAATCCAGGGGTGG - Intronic
925914934 2:8598051-8598073 GAGTGGAATAAGGCCAAGAGAGG - Intergenic
926376937 2:12239761-12239783 GTGGGGCATAAGTTCAAGACTGG + Intergenic
926594306 2:14773728-14773750 GCGGGGAATAAATCCTGGTGTGG - Intergenic
927164727 2:20306517-20306539 GTGGGGAAAAAAGGAAAGAGAGG + Intronic
927451943 2:23216243-23216265 GTGGGTCAGAAATTCAAGAGTGG - Intergenic
929653264 2:43703604-43703626 GTGGGGAGAAAAACCATGAGTGG - Intronic
931869465 2:66443451-66443473 ATTAGGAATAAATCCAAGATAGG + Intronic
931926291 2:67076113-67076135 GTGGGCCATAAATCACAGAGAGG + Intergenic
932763835 2:74457900-74457922 GTGGGGAAGATACTCAAGAGCGG - Exonic
932785106 2:74593931-74593953 GTGAGGAAGAAATCCATGAAAGG + Intronic
935916175 2:107952696-107952718 TTGGAGAATAAACCCGAGAGGGG - Intergenic
935959215 2:108408018-108408040 CTGGGGTATAAACCTAAGAGGGG + Intergenic
937719588 2:125078422-125078444 CTGAGGATTAAATACAAGAGTGG - Intergenic
939755033 2:146099832-146099854 GTGAGGAATAAATTTATGAGAGG + Intergenic
941360752 2:164548559-164548581 TTTGGGTATATATCCAAGAGAGG + Intronic
944297012 2:198077049-198077071 GAGAGTAATAAATCCAGGAGAGG - Intronic
945242092 2:207685735-207685757 GTGGTGAAAAAATTTAAGAGGGG - Intergenic
1169749843 20:8980836-8980858 GTGGTGACTAAGTTCAAGAGTGG - Intergenic
1170590351 20:17766766-17766788 GTGGGGTATACAGCCAGGAGTGG + Intergenic
1170787410 20:19479571-19479593 GTGGGGAAGAGAGACAAGAGAGG + Intronic
1171041829 20:21771274-21771296 GAAGGGAATAAATCAAAGAAGGG - Intergenic
1171304288 20:24091972-24091994 CTGGAGAATAAACCCCAGAGAGG + Intergenic
1172039416 20:32033327-32033349 TTGGGCTCTAAATCCAAGAGTGG + Intergenic
1172209947 20:33190281-33190303 GTGGGGAAGAAATCCTGTAGTGG + Intergenic
1173965588 20:47110080-47110102 GTGGGGATTAAATGAGAGAGAGG - Intronic
1174048542 20:47751004-47751026 GAGGAGAATAAAGCCAGGAGGGG - Intronic
1174368179 20:50068805-50068827 GTGGGCAACCAAGCCAAGAGAGG + Intergenic
1176003734 20:62847915-62847937 GCTGGGAATGGATCCAAGAGAGG + Intronic
1176624464 21:9081695-9081717 CTGGGGTATATATCCAACAGTGG + Intergenic
1176973513 21:15291688-15291710 GAGGGGAAAAAAGCCAAGAAAGG + Intergenic
1178726699 21:35058819-35058841 GTGGGGAATGAATAAAAGAAAGG + Intronic
1179918630 21:44494776-44494798 GTGGGGAAGACATGCAAAAGGGG - Intergenic
1179941505 21:44641551-44641573 GTGGGGAGAAAATCCAAGAATGG + Intronic
1181616185 22:24056203-24056225 GGGGGAGATAAATCCAAGAAAGG + Exonic
949232640 3:1769478-1769500 TTGGGGAATAACACCAGGAGTGG - Intergenic
951097051 3:18644538-18644560 GTGGGGAGCATATCAAAGAGGGG + Intergenic
955500284 3:59576459-59576481 GAGGGAAATAAAGCCCAGAGAGG + Intergenic
957704961 3:83769458-83769480 GTTGGGAATAAGTCCTAGAATGG - Intergenic
960082369 3:113554804-113554826 GTGGGGGATAAAAATAAGAGGGG - Intronic
961139366 3:124542870-124542892 GTGGGTCAGAAATCCAAGATTGG + Intronic
962850397 3:139304107-139304129 GCGGGCAAGAAATCCAAGACAGG - Intronic
963321037 3:143809629-143809651 GAGGAGAAAAAATCCAAGCGAGG + Intronic
965416712 3:168403925-168403947 GTGAAGAATAACTCCAATAGTGG - Intergenic
966417832 3:179707571-179707593 GTGGGGAAGAAAGACAAGAAAGG - Intronic
967667729 3:192193698-192193720 CTGGGGAATCATTCCAAGATAGG - Intronic
968976690 4:3825788-3825810 GTGGGGCAGAAATTCAGGAGGGG - Intergenic
970002032 4:11373705-11373727 GTGTTGAATAAACCCAAGATCGG + Intergenic
970290123 4:14562839-14562861 GAGAGGAATAAATCCATTAGTGG - Intergenic
971634076 4:29034096-29034118 TTGGGGAATAAACCTGAGAGGGG + Intergenic
972720404 4:41691167-41691189 GTGGGGAATAAATCCAAGAGGGG - Intronic
973090149 4:46125354-46125376 GTGGAGAATCAATCAAAGAGGGG - Intergenic
973983118 4:56323352-56323374 GTGGGGAATAAGACAAAGAACGG - Intronic
974335307 4:60536078-60536100 AGGGAGAATAAAGCCAAGAGTGG - Intergenic
974367220 4:60965895-60965917 GTGGGACATTAATACAAGAGAGG - Intergenic
974948186 4:68553774-68553796 TTGGGGAATAAAAACAATAGAGG - Intronic
974957254 4:68657052-68657074 TTGGGGAATAAAAACAATAGAGG - Intronic
976311897 4:83621205-83621227 GTGGGGAGTCAAGCCTAGAGTGG - Intergenic
976741811 4:88364435-88364457 GTGGGGAAAAAATCCCACTGTGG - Intergenic
978762634 4:112371088-112371110 CTGGGGAATAAATGCAATATTGG - Intronic
979514630 4:121593431-121593453 GTTGGGGATATATCTAAGAGTGG - Intergenic
983455906 4:167964216-167964238 GTGGTCAATAGACCCAAGAGTGG - Intergenic
983619437 4:169744837-169744859 GTGTTGAATAAACCCAAGATTGG - Intronic
983833808 4:172365085-172365107 TTGGAGAATAAATCTGAGAGGGG + Intronic
987187034 5:15432614-15432636 AAGGAGAATAAATCCAACAGAGG + Intergenic
987340876 5:16937482-16937504 CTTAGGAATAAATCCTAGAGTGG - Intergenic
987341766 5:16945742-16945764 GTGGGGAATATACCTAGGAGTGG + Intergenic
989090073 5:37721282-37721304 GTGGGAAATAAATAAAAGCGGGG - Intronic
990488304 5:56280235-56280257 AATGGGAATAAATCCAAGTGAGG + Intergenic
994715592 5:103318115-103318137 CTTGGGTATAAATCTAAGAGTGG + Intergenic
998545838 5:143026776-143026798 GTGGGGAATAAACCGTAGTGGGG + Intronic
1001173020 5:169439289-169439311 GTGGGAACAAAATGCAAGAGAGG + Intergenic
1001923683 5:175620448-175620470 GTGTGGCAGAAATTCAAGAGAGG + Intergenic
1002271592 5:178075939-178075961 CTGGGTTATAAACCCAAGAGAGG - Intergenic
1003827037 6:9964583-9964605 GTGGGGCATAAGATCAAGAGAGG - Intronic
1005363644 6:25056003-25056025 ATGGGGAATGAATCCAGGAGTGG + Intergenic
1006657636 6:35609630-35609652 ATGGATAATAAATCCAGGAGAGG - Intronic
1007850191 6:44795283-44795305 GTGGAGAATAAATGAAAGATTGG - Intergenic
1011621432 6:89246928-89246950 CCTGGGAATAAATCTAAGAGTGG - Intergenic
1013034845 6:106371452-106371474 GTGGGGAAGGAAGCCAACAGTGG - Intergenic
1014281808 6:119449696-119449718 GTGGGAAATTAAACCAAAAGAGG - Intergenic
1015776425 6:136819531-136819553 ATGGGAAATAATTCCAAGAAAGG - Intergenic
1016726416 6:147374679-147374701 GTGGGGAAAGAAGCCCAGAGCGG + Intronic
1016781567 6:147965034-147965056 TTGGGGTATAGATCTAAGAGTGG + Intergenic
1017937778 6:159021688-159021710 GTGAGGGAGAAATCCCAGAGAGG + Intergenic
1018066660 6:160129270-160129292 TTGGGGAAGAAAACCAGGAGTGG - Intronic
1019189857 6:170245622-170245644 ATGAGGAATAAATCCAGGAGAGG + Intergenic
1019564536 7:1672898-1672920 GTGGTGCATAAATACACGAGGGG + Intergenic
1019645687 7:2127602-2127624 GTGGGGAAAAAAGGCAAGAGAGG + Intronic
1021352231 7:19609125-19609147 GTGGGGAACAAAACTAAAAGAGG + Intergenic
1021791152 7:24207119-24207141 GTGTGGTATATATCTAAGAGTGG - Intergenic
1022012538 7:26321374-26321396 GTGGGAAAGAAAACCAAGACTGG - Intronic
1022265400 7:28748834-28748856 GAAAGGAATAAATGCAAGAGGGG + Intronic
1023931440 7:44708777-44708799 GTGGGGAGGGAGTCCAAGAGAGG - Exonic
1025987870 7:66471582-66471604 GTGGGGAATAATTTCAATAGAGG - Intergenic
1026408307 7:70091809-70091831 GTTGGGTATAAATCCAACATTGG - Intronic
1027210855 7:76147497-76147519 GTGGGGAATAATTTCAATAGAGG - Intergenic
1028068878 7:86424313-86424335 GTGAGGAAGAAATAGAAGAGGGG + Intergenic
1030261139 7:107565130-107565152 GGGGGGAATAAAGCCAAGGAAGG - Intronic
1031474959 7:122210132-122210154 TTGGGGAATGAACCCAATAGTGG - Intergenic
1035061648 7:156073863-156073885 GTGGGGAATGAACCCAATACTGG - Intergenic
1036996090 8:13658279-13658301 GTCGTGAATCAATCAAAGAGTGG - Intergenic
1037102231 8:15061008-15061030 GTGTGGAAGAAATCCCAGAAAGG - Intronic
1037956484 8:23064283-23064305 GAGGGGAGTAAAAACAAGAGAGG + Intronic
1040998470 8:53425668-53425690 GTGGGGAATAGATTTAAGAAGGG - Intergenic
1041998587 8:64093156-64093178 GTGGATAAGTAATCCAAGAGTGG - Intergenic
1042391110 8:68235634-68235656 GTGGGGGAAAATTACAAGAGGGG + Exonic
1045862824 8:106832041-106832063 TTTGGGAATCAATCCAAGAAGGG - Intergenic
1046123848 8:109879795-109879817 GGGGAGAATTAATCCAAAAGTGG - Intergenic
1047041351 8:120999720-120999742 TTGGGATATAGATCCAAGAGTGG + Intergenic
1048306646 8:133289286-133289308 GTGGGGCTTAAATTCAAGAATGG + Intronic
1049046870 8:140159314-140159336 GTGTGGGATAAATCCATGACTGG - Intronic
1050405205 9:5301639-5301661 GAGGGGAGTAAATCTAAGTGCGG + Intronic
1051006079 9:12346184-12346206 GTGATGGATGAATCCAAGAGGGG + Intergenic
1051059889 9:13033482-13033504 GTGGGGAATAAACGCTATAGAGG + Intergenic
1051129374 9:13842159-13842181 ATGGAGAATATAGCCAAGAGAGG + Intergenic
1055361695 9:75497807-75497829 GTGGGGAATAGATCATAGGGTGG - Intergenic
1060864181 9:126981836-126981858 GTGGGTGAAGAATCCAAGAGTGG + Intronic
1061624765 9:131835253-131835275 GTGGGGAAGAAACCCCAGAAAGG + Intergenic
1203747645 Un_GL000218v1:52125-52147 CTGGGGTATATATCCAACAGTGG + Intergenic
1185497693 X:567936-567958 GTGGGGAATATCTCCAACACAGG - Intergenic
1185807629 X:3074777-3074799 GTGAGGAATAAATCAAATAGAGG + Intronic
1186758682 X:12700533-12700555 GTGGGGATCAAATTGAAGAGTGG - Intronic
1187236137 X:17469318-17469340 GTTGGGTATATATCCAAGGGAGG + Intronic
1187820998 X:23287988-23288010 GTTGGGCATAAGTCTAAGAGTGG - Intergenic
1187998931 X:24959922-24959944 GTGGAGGATAAATCAAAGGGGGG - Intronic
1188956835 X:36443379-36443401 TTGGGGTATAAAACCCAGAGTGG - Intergenic
1189686394 X:43568093-43568115 ATGGGGAAAAAATCCATGACTGG + Intergenic
1190219236 X:48500344-48500366 GTGGGGTAGAAAACCAAGGGCGG + Intergenic
1191710105 X:64140402-64140424 GTGGGTAAAAAATCCCAGGGAGG + Intergenic
1192114737 X:68399279-68399301 GTGGAGAATGAATTCAAGACAGG - Intronic
1193167301 X:78295394-78295416 GTGGGGTATATATCCAGCAGTGG + Intronic
1193279184 X:79627036-79627058 CTGGTGAATATATCCTAGAGGGG + Intergenic
1195030322 X:100921465-100921487 GTGGGGAAAAAAGACAAAAGAGG + Intronic
1195255037 X:103082035-103082057 GTGGGAAACACATCCCAGAGCGG + Intronic
1195515552 X:105771575-105771597 GTTTGGAATAGATCCAACAGTGG + Intergenic
1195824221 X:108980012-108980034 GTGGGGAATAAACTCAAGGTGGG + Intergenic
1196091770 X:111751620-111751642 GTAGGAAATAAATTCATGAGTGG - Intronic
1198100352 X:133416490-133416512 GTGGGGACTGAGTCCCAGAGGGG - Intergenic
1198500382 X:137238889-137238911 CTGGAGAATAAATCAAGGAGAGG + Intergenic
1199600352 X:149537998-149538020 GTGGGGAAGGAACCCAGGAGGGG + Intergenic
1199650233 X:149941942-149941964 GTGGGGAAGGAACCCAGGAGGGG - Intergenic
1201160975 Y:11167111-11167133 CTGGGGTATATATCCAACAGTGG + Intergenic
1201271198 Y:12255751-12255773 GTGAGGAATAAATCAAATAGAGG - Intergenic
1201332644 Y:12842555-12842577 ATGGTGAATACATCAAAGAGAGG - Intronic