ID: 972725097

View in Genome Browser
Species Human (GRCh38)
Location 4:41740432-41740454
Sequence CTTTGCAATCCCCAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972725097_972725102 -8 Left 972725097 4:41740432-41740454 CCCTCCTCCTGGGGATTGCAAAG No data
Right 972725102 4:41740447-41740469 TTGCAAAGCCTTTCAGGCCTTGG No data
972725097_972725106 10 Left 972725097 4:41740432-41740454 CCCTCCTCCTGGGGATTGCAAAG No data
Right 972725106 4:41740465-41740487 CTTGGGCTTCCTTCTGAGTCTGG No data
972725097_972725108 15 Left 972725097 4:41740432-41740454 CCCTCCTCCTGGGGATTGCAAAG No data
Right 972725108 4:41740470-41740492 GCTTCCTTCTGAGTCTGGCTGGG No data
972725097_972725103 -7 Left 972725097 4:41740432-41740454 CCCTCCTCCTGGGGATTGCAAAG No data
Right 972725103 4:41740448-41740470 TGCAAAGCCTTTCAGGCCTTGGG No data
972725097_972725107 14 Left 972725097 4:41740432-41740454 CCCTCCTCCTGGGGATTGCAAAG No data
Right 972725107 4:41740469-41740491 GGCTTCCTTCTGAGTCTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972725097 Original CRISPR CTTTGCAATCCCCAGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr