ID: 972726852

View in Genome Browser
Species Human (GRCh38)
Location 4:41752038-41752060
Sequence CCCGGGGTCCTGCTTCTGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972726838_972726852 16 Left 972726838 4:41751999-41752021 CCACCCCTGGCCTATCGTCCCTC No data
Right 972726852 4:41752038-41752060 CCCGGGGTCCTGCTTCTGCTTGG No data
972726841_972726852 11 Left 972726841 4:41752004-41752026 CCTGGCCTATCGTCCCTCTGCCC No data
Right 972726852 4:41752038-41752060 CCCGGGGTCCTGCTTCTGCTTGG No data
972726832_972726852 26 Left 972726832 4:41751989-41752011 CCCTCCCCCACCACCCCTGGCCT No data
Right 972726852 4:41752038-41752060 CCCGGGGTCCTGCTTCTGCTTGG No data
972726844_972726852 -2 Left 972726844 4:41752017-41752039 CCCTCTGCCCGTCTTTTGTGGCC No data
Right 972726852 4:41752038-41752060 CCCGGGGTCCTGCTTCTGCTTGG No data
972726840_972726852 12 Left 972726840 4:41752003-41752025 CCCTGGCCTATCGTCCCTCTGCC No data
Right 972726852 4:41752038-41752060 CCCGGGGTCCTGCTTCTGCTTGG No data
972726835_972726852 21 Left 972726835 4:41751994-41752016 CCCCACCACCCCTGGCCTATCGT No data
Right 972726852 4:41752038-41752060 CCCGGGGTCCTGCTTCTGCTTGG No data
972726830_972726852 30 Left 972726830 4:41751985-41752007 CCATCCCTCCCCCACCACCCCTG No data
Right 972726852 4:41752038-41752060 CCCGGGGTCCTGCTTCTGCTTGG No data
972726842_972726852 6 Left 972726842 4:41752009-41752031 CCTATCGTCCCTCTGCCCGTCTT No data
Right 972726852 4:41752038-41752060 CCCGGGGTCCTGCTTCTGCTTGG No data
972726833_972726852 25 Left 972726833 4:41751990-41752012 CCTCCCCCACCACCCCTGGCCTA No data
Right 972726852 4:41752038-41752060 CCCGGGGTCCTGCTTCTGCTTGG No data
972726850_972726852 -10 Left 972726850 4:41752025-41752047 CCGTCTTTTGTGGCCCGGGGTCC No data
Right 972726852 4:41752038-41752060 CCCGGGGTCCTGCTTCTGCTTGG No data
972726837_972726852 19 Left 972726837 4:41751996-41752018 CCACCACCCCTGGCCTATCGTCC No data
Right 972726852 4:41752038-41752060 CCCGGGGTCCTGCTTCTGCTTGG No data
972726839_972726852 13 Left 972726839 4:41752002-41752024 CCCCTGGCCTATCGTCCCTCTGC No data
Right 972726852 4:41752038-41752060 CCCGGGGTCCTGCTTCTGCTTGG No data
972726836_972726852 20 Left 972726836 4:41751995-41752017 CCCACCACCCCTGGCCTATCGTC No data
Right 972726852 4:41752038-41752060 CCCGGGGTCCTGCTTCTGCTTGG No data
972726849_972726852 -9 Left 972726849 4:41752024-41752046 CCCGTCTTTTGTGGCCCGGGGTC No data
Right 972726852 4:41752038-41752060 CCCGGGGTCCTGCTTCTGCTTGG No data
972726845_972726852 -3 Left 972726845 4:41752018-41752040 CCTCTGCCCGTCTTTTGTGGCCC No data
Right 972726852 4:41752038-41752060 CCCGGGGTCCTGCTTCTGCTTGG No data
972726834_972726852 22 Left 972726834 4:41751993-41752015 CCCCCACCACCCCTGGCCTATCG No data
Right 972726852 4:41752038-41752060 CCCGGGGTCCTGCTTCTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972726852 Original CRISPR CCCGGGGTCCTGCTTCTGCT TGG Intergenic
No off target data available for this crispr