ID: 972727523

View in Genome Browser
Species Human (GRCh38)
Location 4:41758201-41758223
Sequence TTAGGGGGTTTTCAGCAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972727523_972727529 0 Left 972727523 4:41758201-41758223 CCTACCTGCTGAAAACCCCCTAA No data
Right 972727529 4:41758224-41758246 GAGTCACTGCTGCTGCCCCCTGG No data
972727523_972727534 19 Left 972727523 4:41758201-41758223 CCTACCTGCTGAAAACCCCCTAA No data
Right 972727534 4:41758243-41758265 CTGGTCTCTGCACATAGAGATGG No data
972727523_972727536 21 Left 972727523 4:41758201-41758223 CCTACCTGCTGAAAACCCCCTAA No data
Right 972727536 4:41758245-41758267 GGTCTCTGCACATAGAGATGGGG No data
972727523_972727535 20 Left 972727523 4:41758201-41758223 CCTACCTGCTGAAAACCCCCTAA No data
Right 972727535 4:41758244-41758266 TGGTCTCTGCACATAGAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972727523 Original CRISPR TTAGGGGGTTTTCAGCAGGT AGG (reversed) Intergenic
No off target data available for this crispr