ID: 972731609

View in Genome Browser
Species Human (GRCh38)
Location 4:41800500-41800522
Sequence AGTATATGGTTTAGTGGTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972731609_972731613 -5 Left 972731609 4:41800500-41800522 CCAATACCACTAAACCATATACT No data
Right 972731613 4:41800518-41800540 ATACTTTAAAATGGTCAAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972731609 Original CRISPR AGTATATGGTTTAGTGGTAT TGG (reversed) Intergenic
No off target data available for this crispr