ID: 972732562

View in Genome Browser
Species Human (GRCh38)
Location 4:41809213-41809235
Sequence AAGGGGAAACAGTAGTAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972732562_972732568 6 Left 972732562 4:41809213-41809235 CCTTCCTACTACTGTTTCCCCTT No data
Right 972732568 4:41809242-41809264 TGAAATAAGCAGCCAAGTCCTGG No data
972732562_972732571 22 Left 972732562 4:41809213-41809235 CCTTCCTACTACTGTTTCCCCTT No data
Right 972732571 4:41809258-41809280 GTCCTGGGAGACCTCCTTCCAGG No data
972732562_972732569 7 Left 972732562 4:41809213-41809235 CCTTCCTACTACTGTTTCCCCTT No data
Right 972732569 4:41809243-41809265 GAAATAAGCAGCCAAGTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972732562 Original CRISPR AAGGGGAAACAGTAGTAGGA AGG (reversed) Intergenic
No off target data available for this crispr