ID: 972733891

View in Genome Browser
Species Human (GRCh38)
Location 4:41821155-41821177
Sequence AGTTAGGCTGAGATCTGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972733887_972733891 -7 Left 972733887 4:41821139-41821161 CCATGAACCACAGCAGAGTTAGG No data
Right 972733891 4:41821155-41821177 AGTTAGGCTGAGATCTGGACTGG No data
972733886_972733891 0 Left 972733886 4:41821132-41821154 CCAGCTGCCATGAACCACAGCAG No data
Right 972733891 4:41821155-41821177 AGTTAGGCTGAGATCTGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972733891 Original CRISPR AGTTAGGCTGAGATCTGGAC TGG Intergenic
No off target data available for this crispr