ID: 972736006

View in Genome Browser
Species Human (GRCh38)
Location 4:41842189-41842211
Sequence GCTCCCTTTTTTGCTGCATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972735999_972736006 30 Left 972735999 4:41842136-41842158 CCTCTTCATCTTCCTCCTCTTCC 0: 3
1: 57
2: 701
3: 3166
4: 11118
Right 972736006 4:41842189-41842211 GCTCCCTTTTTTGCTGCATCAGG No data
972736001_972736006 15 Left 972736001 4:41842151-41842173 CCTCTTCCTTCTTTTCCTTGCTT No data
Right 972736006 4:41842189-41842211 GCTCCCTTTTTTGCTGCATCAGG No data
972736003_972736006 0 Left 972736003 4:41842166-41842188 CCTTGCTTTGTTCAGCCTTGATG No data
Right 972736006 4:41842189-41842211 GCTCCCTTTTTTGCTGCATCAGG No data
972736002_972736006 9 Left 972736002 4:41842157-41842179 CCTTCTTTTCCTTGCTTTGTTCA No data
Right 972736006 4:41842189-41842211 GCTCCCTTTTTTGCTGCATCAGG No data
972736000_972736006 18 Left 972736000 4:41842148-41842170 CCTCCTCTTCCTTCTTTTCCTTG No data
Right 972736006 4:41842189-41842211 GCTCCCTTTTTTGCTGCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972736006 Original CRISPR GCTCCCTTTTTTGCTGCATC AGG Intergenic
No off target data available for this crispr