ID: 972737990

View in Genome Browser
Species Human (GRCh38)
Location 4:41864209-41864231
Sequence TTGCAGGCCAGGATCTACTT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972737985_972737990 4 Left 972737985 4:41864182-41864204 CCACCAGATGTTCAGGCCTCACT No data
Right 972737990 4:41864209-41864231 TTGCAGGCCAGGATCTACTTCGG No data
972737983_972737990 22 Left 972737983 4:41864164-41864186 CCAGGATGACTTGCACGGCCACC No data
Right 972737990 4:41864209-41864231 TTGCAGGCCAGGATCTACTTCGG No data
972737982_972737990 23 Left 972737982 4:41864163-41864185 CCCAGGATGACTTGCACGGCCAC No data
Right 972737990 4:41864209-41864231 TTGCAGGCCAGGATCTACTTCGG No data
972737986_972737990 1 Left 972737986 4:41864185-41864207 CCAGATGTTCAGGCCTCACTCTT No data
Right 972737990 4:41864209-41864231 TTGCAGGCCAGGATCTACTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972737990 Original CRISPR TTGCAGGCCAGGATCTACTT CGG Intergenic
No off target data available for this crispr