ID: 972741753 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 4:41893648-41893670 |
Sequence | GGCTCAATTTTTTTAGAGAC AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
972741753_972741759 | 3 | Left | 972741753 | 4:41893648-41893670 | CCTGTCTCTAAAAAAATTGAGCC | No data | ||
Right | 972741759 | 4:41893674-41893696 | ATGGGGCTTGAGAAGTACCAGGG | No data | ||||
972741753_972741758 | 2 | Left | 972741753 | 4:41893648-41893670 | CCTGTCTCTAAAAAAATTGAGCC | No data | ||
Right | 972741758 | 4:41893673-41893695 | GATGGGGCTTGAGAAGTACCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
972741753 | Original CRISPR | GGCTCAATTTTTTTAGAGAC AGG (reversed) | Intergenic | ||