ID: 972741753

View in Genome Browser
Species Human (GRCh38)
Location 4:41893648-41893670
Sequence GGCTCAATTTTTTTAGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972741753_972741759 3 Left 972741753 4:41893648-41893670 CCTGTCTCTAAAAAAATTGAGCC No data
Right 972741759 4:41893674-41893696 ATGGGGCTTGAGAAGTACCAGGG No data
972741753_972741758 2 Left 972741753 4:41893648-41893670 CCTGTCTCTAAAAAAATTGAGCC No data
Right 972741758 4:41893673-41893695 GATGGGGCTTGAGAAGTACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972741753 Original CRISPR GGCTCAATTTTTTTAGAGAC AGG (reversed) Intergenic