ID: 972746709

View in Genome Browser
Species Human (GRCh38)
Location 4:41940512-41940534
Sequence CAGTATAAGAACTTGAATTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972746706_972746709 -5 Left 972746706 4:41940494-41940516 CCTGAGCACCTATTTTGCCAGTA 0: 1
1: 0
2: 1
3: 7
4: 76
Right 972746709 4:41940512-41940534 CAGTATAAGAACTTGAATTTAGG No data
972746705_972746709 4 Left 972746705 4:41940485-41940507 CCGAAATTTCCTGAGCACCTATT 0: 1
1: 0
2: 11
3: 69
4: 540
Right 972746709 4:41940512-41940534 CAGTATAAGAACTTGAATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972746709 Original CRISPR CAGTATAAGAACTTGAATTT AGG Intronic
No off target data available for this crispr