ID: 972750784

View in Genome Browser
Species Human (GRCh38)
Location 4:41986559-41986581
Sequence AATTAAGCTGAGACAGAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 260}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972750784_972750787 24 Left 972750784 4:41986559-41986581 CCATGCTCTGTCTCAGCTTAATT 0: 1
1: 0
2: 0
3: 21
4: 260
Right 972750787 4:41986606-41986628 ACAGTCAGTCTCTTGCCTCCAGG 0: 1
1: 0
2: 1
3: 16
4: 188
972750784_972750786 -6 Left 972750784 4:41986559-41986581 CCATGCTCTGTCTCAGCTTAATT 0: 1
1: 0
2: 0
3: 21
4: 260
Right 972750786 4:41986576-41986598 TTAATTCTTCTCAAGGATAAAGG 0: 1
1: 0
2: 3
3: 22
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972750784 Original CRISPR AATTAAGCTGAGACAGAGCA TGG (reversed) Intergenic
901764205 1:11489589-11489611 AATCAGACTGAGGCAGAGCAAGG - Intronic
902490594 1:16778099-16778121 AGATAAGATGAGACAGAGTAAGG + Intronic
904660671 1:32082288-32082310 AATTAGGCTTAGACAAAGAATGG - Intronic
904753800 1:32756984-32757006 AATGGAGTTGAGACTGAGCATGG + Intronic
907374959 1:54029127-54029149 AGATAAGCTCAGACAGTGCAGGG + Intergenic
909758054 1:79252405-79252427 AATAAAGCTGAACCAGAACAAGG - Intergenic
910124888 1:83829648-83829670 AAGTAGGCAGAGACAGATCATGG - Intergenic
910476909 1:87617147-87617169 ATTTAAGCAGAGAGAAAGCAGGG + Intergenic
910931196 1:92444141-92444163 AGTTAGGTTGAGACAGACCAAGG - Intergenic
911228742 1:95336990-95337012 AAGAAAGCAGAGCCAGAGCAGGG - Intergenic
911769269 1:101718688-101718710 AATTAGGCAGATACAGAGAAAGG - Intergenic
912760352 1:112360643-112360665 AATGAAGTTTAGAAAGAGCAGGG + Intergenic
913178877 1:116299897-116299919 AATGAAGCTGAGAGAAAGGAAGG - Intergenic
913197250 1:116467597-116467619 AAATTAAATGAGACAGAGCATGG + Intergenic
917843687 1:179002961-179002983 AAGTGAGCAGGGACAGAGCAAGG - Intergenic
920882806 1:209896108-209896130 AATGGAAGTGAGACAGAGCAGGG - Intergenic
921145142 1:212347834-212347856 AATTCAGCTGAGGCTGGGCATGG - Intronic
922325405 1:224523893-224523915 CATTAAGCTGAGAAGGAGGATGG + Intronic
923423325 1:233843025-233843047 AATGGACCTGAGACACAGCAGGG + Intergenic
923529848 1:234804436-234804458 AGATAAGATGAGACAGAGTAAGG - Intergenic
923775836 1:236977751-236977773 CAGGAAGCTGAGACAGAGAAGGG - Intergenic
1063425267 10:5945755-5945777 AATGAAACTGAAAAAGAGCAAGG - Intronic
1064202215 10:13294393-13294415 AATTAAGCCGACGCAAAGCAAGG + Intronic
1065118208 10:22502564-22502586 AACTAAGATGAGGCTGAGCACGG - Intergenic
1066429995 10:35342491-35342513 AAGTAAGCAGAGACAGGTCATGG - Intronic
1067245339 10:44536753-44536775 GCATAAGCAGAGACAGAGCAAGG - Intergenic
1067399314 10:45956496-45956518 ACATCTGCTGAGACAGAGCAGGG + Intergenic
1068039247 10:51801928-51801950 TATAAAGCTGAGACAGTGCTGGG - Intronic
1068248146 10:54400024-54400046 AATAAGGCAGAGAGAGAGCAAGG + Intronic
1069340078 10:67399480-67399502 AGTTAGGATGGGACAGAGCATGG - Intronic
1069835434 10:71305023-71305045 AATGAAGTAGAGACAGAGGAAGG - Intergenic
1070726149 10:78792405-78792427 AACTCAGCTGGGACAGAGCAGGG + Intergenic
1073556087 10:104453142-104453164 ATTTAAGGTGAGAGAGGGCAGGG + Intronic
1073750521 10:106521474-106521496 CATTCAGCTGAGAAATAGCAGGG - Intergenic
1074163655 10:110856076-110856098 AAAAAAGCAGAGAGAGAGCAAGG - Intergenic
1074196179 10:111187446-111187468 GATAAAGCCAAGACAGAGCAGGG - Intergenic
1074835429 10:117287886-117287908 AATTTTGCTGAGACATAGTATGG - Intronic
1075133815 10:119764475-119764497 AAGTAAGCTGAGGAAGAGGAAGG - Intronic
1075575692 10:123575886-123575908 ATATAAGATGAGACAGAGTAAGG - Intergenic
1075988518 10:126810834-126810856 AATTAAGTTGAAAAAGAGGAGGG + Intergenic
1077302110 11:1852180-1852202 ACTTAAGCTGGGCCAGAGTAGGG - Intergenic
1077782664 11:5348533-5348555 AATTAAGCTTGGACGGAGCTTGG + Intronic
1078692366 11:13595018-13595040 AATTAAAATGAGACATAGCAGGG + Intergenic
1079815027 11:25045427-25045449 TATTAAGTTCACACAGAGCAAGG - Intronic
1080242467 11:30142439-30142461 AATTAAGCTGAAACTGTACAGGG + Intergenic
1080994288 11:37581002-37581024 AATTATGCTGAGACAGGTAATGG + Intergenic
1081380484 11:42408510-42408532 GCTTAATCAGAGACAGAGCATGG + Intergenic
1082926591 11:58553959-58553981 GAGCAAGCTGAGACACAGCAAGG - Intronic
1083448908 11:62729241-62729263 AATTAAGTTGCCATAGAGCAGGG + Intronic
1085572434 11:77571330-77571352 CATTAAACAAAGACAGAGCAGGG - Intronic
1085573005 11:77575874-77575896 CATTAAACAAAGACAGAGCAGGG - Intronic
1086283420 11:85217597-85217619 AATTCAGGTGAGACATAGAAAGG - Intronic
1086905544 11:92414218-92414240 AAACAAGCTGAGAGAGATCACGG + Intronic
1090625960 11:128609136-128609158 AAATTAGCTTAGACAGAACAAGG - Intergenic
1090996922 11:131875035-131875057 ACTTAAGCTGAGACAGAACTGGG + Intronic
1092161923 12:6319876-6319898 AATGAAGCTGGGACAGAGAAGGG + Intronic
1093852758 12:24060835-24060857 AATGAAGCTAACACAGAGAAAGG + Intergenic
1094402549 12:30077596-30077618 AATTAAGGTGAGAGATAACAGGG - Intergenic
1094667230 12:32532854-32532876 AATTAATCTGATACAGAATAGGG - Intronic
1096066169 12:48742560-48742582 AATGAAGCTGAGGCCGGGCACGG - Intergenic
1096368354 12:51047710-51047732 ATTTAAGTTGAGACAGAGCTTGG + Intergenic
1096778976 12:53981344-53981366 AATTCAGCTGGGGCAGAGCCTGG + Intergenic
1098179215 12:67828238-67828260 AATGAAAGTGAGTCAGAGCAGGG + Intergenic
1098226081 12:68326345-68326367 GATCAAGTTGAGACAGAGAAGGG - Intronic
1098499499 12:71174392-71174414 AATTAAGCTAACAGACAGCAGGG + Intronic
1098518605 12:71409138-71409160 ATTTAAGCCGAGTGAGAGCATGG + Intronic
1101440607 12:104701796-104701818 AATTCAGGTGGGACTGAGCAGGG + Intronic
1102775246 12:115512995-115513017 ATCAAAGCTGAGAGAGAGCATGG - Intergenic
1103464070 12:121128110-121128132 GACTAAGCTGAGGCAGAGTAGGG - Intergenic
1103932512 12:124458081-124458103 AATGCAGCTGAGTCACAGCAGGG - Intronic
1105392215 13:19990993-19991015 AATGGAGATGAGACAGATCATGG - Intronic
1105661267 13:22498186-22498208 AATTAAGCTGAGGCAGGTGACGG - Intergenic
1106468681 13:30035836-30035858 AATTCAGGTGGGCCAGAGCATGG - Intergenic
1107560420 13:41552676-41552698 AATTAAGGTGAAACAGAGAGGGG - Intergenic
1109707422 13:66114604-66114626 ATATAAACTGAGATAGAGCAAGG - Intergenic
1110366536 13:74692610-74692632 TATTAAACTGAGATAGAGCTGGG - Intergenic
1112024150 13:95397182-95397204 AATGAAGAGGACACAGAGCAGGG - Intergenic
1113421101 13:110172029-110172051 ACTTCAGCTGAGAAGGAGCAGGG - Intronic
1116430201 14:44837196-44837218 TAGTAATCTGAGACAGAACAAGG + Intergenic
1117708046 14:58493811-58493833 CATTAAGCTGAGAGAGAGAAAGG + Intronic
1118470239 14:66068466-66068488 ACATGAGCTGAGACAGAGCATGG + Intergenic
1119523253 14:75301867-75301889 GATGAGGCTGAGACAGAGGAGGG - Intergenic
1119877291 14:78071695-78071717 AAGTAAACTGAGAAAGAGCTAGG - Intergenic
1121949236 14:98155876-98155898 ACTGAAGCTGAGAGAGAGAAAGG - Intergenic
1125170903 15:36765344-36765366 AATTAAGCTCAGGCTGGGCATGG - Intronic
1125954628 15:43781492-43781514 CAGTGAGCTGAGATAGAGCAAGG + Intronic
1126205128 15:46036604-46036626 AACAAAGCTGAGACCCAGCATGG - Intergenic
1126469632 15:48994528-48994550 AATTTAGATGACACTGAGCATGG - Intronic
1127786027 15:62355353-62355375 AATGAAACTGAGACTGAGAAAGG - Intergenic
1128071988 15:64803231-64803253 AATTAGGCTGAGGCTGGGCACGG + Intergenic
1129033802 15:72637811-72637833 ACTTCAGGTGAGAGAGAGCATGG + Intergenic
1129216079 15:74099405-74099427 ACTTCAGGTGAGAGAGAGCATGG - Intergenic
1129331641 15:74830879-74830901 AATAAGGCTCAGAGAGAGCAGGG - Exonic
1129969898 15:79769121-79769143 AACTAATCAGAGACAGAGCCAGG + Intergenic
1130859051 15:87869801-87869823 TATTAAATTGAGACAGAACATGG + Intronic
1134791347 16:16991950-16991972 AATTAACAAGAGACAGAGCCAGG + Intergenic
1135245718 16:20855314-20855336 AATTAAGCACAGACGGAGCTGGG + Exonic
1135646939 16:24171381-24171403 AAGTGATCTGAGAGAGAGCAGGG + Intronic
1136942921 16:34607117-34607139 AATTAAGCAGAAACATAGAATGG - Intergenic
1137699895 16:50489818-50489840 AATTAGGTTGGGTCAGAGCATGG - Intergenic
1138023057 16:53502545-53502567 CGTTAAGAGGAGACAGAGCAGGG + Intronic
1138108416 16:54304339-54304361 AGGTAAGCTCAGACAGGGCAGGG - Intergenic
1138224429 16:55280739-55280761 AATTAAGATGAATCAGAGCATGG + Intergenic
1140135947 16:72205604-72205626 AATGATGCAAAGACAGAGCATGG + Intergenic
1140342691 16:74180700-74180722 AATAAAGCTGAGTAAGAGCAGGG + Intergenic
1141236204 16:82219615-82219637 ATTTAATCTGAGAAACAGCAAGG - Intergenic
1141697005 16:85624878-85624900 AGCTCAGCTGAGACAGAGCCGGG - Intronic
1142001813 16:87668601-87668623 AAATGAGCTGAGCCAGGGCACGG + Intronic
1144188661 17:12822669-12822691 AATTATGCAGCCACAGAGCAAGG + Intronic
1145052159 17:19671097-19671119 AATGAAACTGTCACAGAGCATGG + Intronic
1146480322 17:33199999-33200021 CAGGAAGCTGGGACAGAGCATGG - Intronic
1147448306 17:40488443-40488465 GATTTTGCTCAGACAGAGCAGGG + Intronic
1147960124 17:44162205-44162227 AATTAAGCTGAGGCAGGAGAGGG - Exonic
1148668805 17:49394811-49394833 AATTAATATGGCACAGAGCAGGG - Intronic
1149498378 17:57133456-57133478 AATTAAGAGGCCACAGAGCATGG + Intergenic
1151288329 17:73129771-73129793 AATTAAGGTGAGGCCGGGCATGG - Intergenic
1152400962 17:80065852-80065874 GATTAAGTAGAAACAGAGCAGGG + Intronic
1152841552 17:82572026-82572048 AAAGAAGGTGAGGCAGAGCATGG - Intronic
1153717103 18:7860824-7860846 AGGAAAGCTGAGACAGAGTAGGG - Intronic
1154208506 18:12358546-12358568 TAGTAAGCTGAGAAAGAGGAAGG + Intronic
1155075151 18:22348383-22348405 TATTGAGCTGTGAGAGAGCAGGG - Intergenic
1155154917 18:23150049-23150071 AGTTCACCAGAGACAGAGCATGG - Intronic
1155332366 18:24731251-24731273 AATGACGCTGTGACAGAGCAGGG - Intergenic
1155483402 18:26314415-26314437 AATTTTGCTGATACAAAGCAAGG + Intronic
1157012322 18:43665669-43665691 AATGCAGTTGAGTCAGAGCAGGG + Intergenic
1159039606 18:63311384-63311406 AGTTAAGCTGCAACAGAGTATGG - Intronic
1159373824 18:67565410-67565432 AATTAACCAGAGAAAGAGGAAGG + Intergenic
1161232910 19:3184033-3184055 AATTCAGCTCAGCCAAAGCAGGG - Intergenic
1162851833 19:13437039-13437061 AATTAAGCAGATACAGAGGAGGG + Intronic
1164769022 19:30793779-30793801 AAGTAAGCTGAAATACAGCAAGG - Intergenic
926979477 2:18552721-18552743 AATGAAGCTGAGAACCAGCATGG + Intergenic
928210788 2:29322167-29322189 AAGAAGGCTGAGACAGAGGAAGG - Intronic
929464685 2:42133917-42133939 AATTAATCTGGGGCAGAGCCTGG - Intergenic
931569967 2:63657928-63657950 AATTAAGCAGATATAAAGCAAGG - Intronic
935063797 2:99630962-99630984 AGTGGAGCTGAGACAGAGGAGGG + Intronic
935373502 2:102371796-102371818 AATCAAGCGGAGGCAGAGCAGGG + Intronic
936847107 2:116850307-116850329 AATTAGTCTGAAATAGAGCAGGG + Intergenic
937558656 2:123193054-123193076 AACTGAGATGAGACTGAGCACGG - Intergenic
937651663 2:124326127-124326149 CATTAAGTGGAGACAGAGGAGGG + Intronic
938180270 2:129176125-129176147 AATAAAGAGGAGACTGAGCAAGG - Intergenic
938344720 2:130558886-130558908 AATATAGCTGAGACAGGGAAGGG - Intergenic
938345113 2:130561834-130561856 AATATAGCTGAGACAGGGAAGGG + Intergenic
939201108 2:139035543-139035565 CATTAAACTGAGACAAAACAAGG - Intergenic
939679706 2:145115428-145115450 AATTAAGGTGAGTCTGTGCAAGG - Intergenic
940060636 2:149562531-149562553 AAACAAGCTGAGAAAGAGAAAGG - Intergenic
940941662 2:159568171-159568193 AATTCACCAGAGACAGACCAAGG - Intronic
941139891 2:161766885-161766907 ACATATGCTGAGACAGATCAGGG - Intronic
941899852 2:170667804-170667826 AATTATGCTGATACCGAGCCAGG + Intergenic
942014638 2:171799602-171799624 GCTTAAGCTGAGAAAAAGCATGG + Intronic
942485914 2:176439646-176439668 AACTAAGCTGAGAGACAGCCTGG - Intergenic
944525345 2:200613334-200613356 AAGTAAGCTGACTGAGAGCATGG - Intronic
944536659 2:200717121-200717143 GATGAAGATGAGACAGGGCAGGG - Intergenic
945739996 2:213647738-213647760 GATTAGGCTGAGACAGATCCTGG - Intronic
945997760 2:216453174-216453196 AATCCAGCTGAGAAAGAGCCCGG + Intronic
947237446 2:227957362-227957384 AATTTAGATAAGACAGAGCAGGG + Intergenic
947269443 2:228317785-228317807 AAGTAAACTGAGGCAGGGCACGG + Intergenic
947351712 2:229253163-229253185 AATGAAGCTCAGACAGACTAAGG + Intronic
947623274 2:231604374-231604396 AATGAGGCTGGGACAGAGCACGG + Intergenic
947759600 2:232594082-232594104 AACTAAGCAGAAACAGAGCCGGG - Intergenic
948172783 2:235918926-235918948 ATTTCAGCTGAGACATATCAGGG + Intronic
948212385 2:236204250-236204272 AAGTAAAGTGAGGCAGAGCATGG - Intronic
1171245185 20:23605045-23605067 CATTAAGTGCAGACAGAGCAAGG + Intronic
1172324926 20:34026961-34026983 ACTTAGGCTGACACAGAGCCTGG + Intronic
1173295197 20:41749456-41749478 AATAGAGCTGGGTCAGAGCAGGG - Intergenic
1173797511 20:45872612-45872634 CACAAAGGTGAGACAGAGCATGG + Intronic
1174530513 20:51209125-51209147 AAGGAAGCTGAGACAGAGAATGG - Intergenic
1174578808 20:51556483-51556505 AATGAGGCAGATACAGAGCATGG - Intronic
1175046048 20:56106518-56106540 CATTGAGATGAGACAGAGCAGGG + Intergenic
1175717076 20:61262313-61262335 CTCTAAGCTGAGAGAGAGCAAGG + Intronic
1177343990 21:19844288-19844310 AATTAAGCTGAGTAAAGGCAGGG - Intergenic
1177398527 21:20569793-20569815 AATTAAGCTGGAAAACAGCAAGG + Intergenic
1179126461 21:38595385-38595407 AATTAAGCAGAGAAGGTGCAGGG + Intronic
1181328429 22:22069720-22069742 AAGTTACCTGAGACAGAGCAGGG + Intergenic
1181769320 22:25113888-25113910 AAACAAACAGAGACAGAGCAAGG - Intronic
950920477 3:16689160-16689182 AACAAGGCTGAGACAGAACAGGG + Intergenic
951251314 3:20396959-20396981 AATAAAGGTGAGAAAGATCAAGG - Intergenic
952206404 3:31185128-31185150 AATGAAACTGAGACACAGAAAGG + Intergenic
952223379 3:31348093-31348115 AAGAAAACTGAGACAGAGAAAGG - Intergenic
953009569 3:39011775-39011797 GGTTAGGATGAGACAGAGCAGGG - Intergenic
955825215 3:62938907-62938929 AATTATGCTGATACAAACCAAGG - Intergenic
955858374 3:63299056-63299078 ATATAAGCTCAGACAAAGCAAGG - Intronic
956841066 3:73140835-73140857 AATTAAGCAGAGACACACCCAGG + Intergenic
958119891 3:89271913-89271935 AAGTAAGCTGAAAAAGAGGAAGG - Intronic
958535931 3:95402969-95402991 AATTAAGTTGAGAAAGAAGAGGG - Intergenic
959914593 3:111802323-111802345 AATAAAGGGGAGACAGAGCAAGG + Intronic
960645214 3:119872936-119872958 AATTAAGCAGAGACAGAGATTGG - Intronic
961062590 3:123844150-123844172 TATTAAACAGAGACAAAGCAAGG + Intronic
965049263 3:163623352-163623374 TATTGAGAAGAGACAGAGCATGG + Intergenic
965206332 3:165722115-165722137 AATGAATCTAAGACAGAGGAAGG + Intergenic
965883487 3:173414872-173414894 AAGCATCCTGAGACAGAGCAGGG + Intronic
966173429 3:177109656-177109678 ATTTAAACTGTGAGAGAGCAGGG - Intronic
966962455 3:184953868-184953890 AATGAAACTGAGATGGAGCAGGG - Intronic
967428893 3:189358999-189359021 AAAGAAACTGAGACATAGCAAGG - Intergenic
969486572 4:7475510-7475532 CAGGAGGCTGAGACAGAGCATGG + Intronic
970374671 4:15444708-15444730 AATTAGGATGTGACAGAGAAGGG + Exonic
970495973 4:16626595-16626617 AATGAAGCTTAGCCAGAGCTGGG - Intronic
971261908 4:25065035-25065057 ATTTAAGGTGAGACAGTGGATGG + Intergenic
971978079 4:33716771-33716793 AATTAAGGTGAATCAAAGCAAGG + Intergenic
972750784 4:41986559-41986581 AATTAAGCTGAGACAGAGCATGG - Intergenic
974057421 4:56998009-56998031 AATTAATTAGAGACAGAGAAAGG + Intronic
975907233 4:79227822-79227844 AATTAATATGAGGAAGAGCAGGG - Intronic
976384408 4:84438879-84438901 TATTATGCTGTGACAGAGAAAGG - Intergenic
978623547 4:110658912-110658934 AACTAAGCTGAGAGAAAGGAAGG - Intergenic
979467161 4:121053927-121053949 AATTTAGCTAAGATGGAGCATGG + Intronic
979629736 4:122887023-122887045 TATTAATATGAGGCAGAGCATGG + Intronic
979670278 4:123354204-123354226 TATTAAGCTGTGCCAGAGGAGGG - Intergenic
980439455 4:132821035-132821057 AATTATTCTGAGACAGAAAAAGG - Intergenic
980834467 4:138173946-138173968 AATGTAGCTTAGACAGAGAAGGG + Intronic
982466078 4:155734105-155734127 ACCTAACCTGAGACAGAGCTGGG - Intergenic
982900044 4:160987635-160987657 ATTGAAGCAGAGACAGAGTAGGG + Intergenic
984426370 4:179591805-179591827 AATTAATGGGAGACATAGCATGG + Intergenic
984579232 4:181491544-181491566 AATTATGCAAAGACAGAGTAAGG + Intergenic
984798232 4:183686720-183686742 ATTAAAGCTGACACAGAGCTTGG - Exonic
988095900 5:26609903-26609925 AATTAAGATGAGGTATAGCAGGG + Intergenic
989807666 5:45630243-45630265 ATTTAAGCAGAGAGGGAGCAAGG + Intronic
990619349 5:57543010-57543032 AATGAAGCTGAGACAAAGAAAGG + Intergenic
995915074 5:117235635-117235657 ACTTAAGCTGACCCTGAGCAGGG - Intergenic
997859790 5:137405987-137406009 AATCAAGGTGTGACAGAGCCAGG - Intronic
998921779 5:147076769-147076791 ACTGAAGAGGAGACAGAGCATGG - Intronic
999256881 5:150214522-150214544 AGTCAGGCGGAGACAGAGCAGGG - Intronic
999799074 5:155016514-155016536 AAACAGCCTGAGACAGAGCAAGG + Exonic
1001561293 5:172670585-172670607 AATGAACCTGGGCCAGAGCATGG - Intronic
1002361447 5:178674617-178674639 AATGAAGCTAAGACAGAGCTTGG - Intergenic
1003274527 6:4637883-4637905 AAGTGATCTGAGAGAGAGCAAGG + Intergenic
1004131274 6:12921941-12921963 AATGAATCTGAGAGAGAGTAAGG - Intronic
1004949828 6:20656426-20656448 AATTAAACTAAGGCAGAGAATGG + Intronic
1008916664 6:56795088-56795110 AATTTAGAGGAAACAGAGCAAGG + Intronic
1009693392 6:67065684-67065706 AATGTAGCTGAGGAAGAGCAAGG - Intergenic
1010186287 6:73147028-73147050 AATTAATCCGACACAGTGCATGG + Intronic
1010617943 6:78036081-78036103 AAATGAGCTGTGACAGTGCAAGG - Intergenic
1010895252 6:81354761-81354783 AATTAGGCTAAGACTGTGCATGG - Intergenic
1011198839 6:84812130-84812152 AATAAAACTGAGACTGTGCATGG - Intergenic
1019894533 7:3973247-3973269 AATTACCCTGAGATAGAACAGGG - Intronic
1022645814 7:32227788-32227810 AATTGATCTAAGAGAGAGCAAGG - Intronic
1023017282 7:35980979-35981001 AAGTAATCCAAGACAGAGCAAGG + Intergenic
1023183280 7:37508054-37508076 AATTAAACAGAGATAGTGCAAGG + Intergenic
1024275466 7:47673543-47673565 AATTAACCTAAGAAAAAGCACGG + Intergenic
1026352914 7:69533198-69533220 AATTAAACTGAGATACAGCTAGG - Intergenic
1026441556 7:70449178-70449200 AAATAAGTAGAGACAAAGCAAGG - Intronic
1029412614 7:100425084-100425106 AATTCACCTGAAACAGAGGAGGG - Exonic
1029791361 7:102846326-102846348 AATTAATCTGAGGCTGGGCATGG + Intronic
1033006705 7:137572941-137572963 ACTTAAGCAGAGATAGGGCAAGG - Intronic
1036509634 8:9388318-9388340 AAAGAAGTTGAGACAGGGCAGGG - Intergenic
1037103439 8:15076334-15076356 AATTGAAGCGAGACAGAGCAAGG + Intronic
1038584383 8:28776132-28776154 AATTAAGCTGAGGCAGTTTAGGG - Intronic
1038875931 8:31549013-31549035 ATTTCAGCTGAGACTGAGGAGGG + Intergenic
1040887447 8:52281410-52281432 AATTAAGATGAGAATGATCAAGG + Intronic
1041770832 8:61471180-61471202 AAGGAAGCTGAGACTCAGCAAGG - Intronic
1045181736 8:99791626-99791648 AACTGAGCTAAGACAGAGTAAGG + Intronic
1045247457 8:100455603-100455625 AAGTAAGCTGGGGCAGGGCATGG - Intergenic
1046424011 8:114022594-114022616 GATTAAGCTTAGAGAGAGAAAGG - Intergenic
1046939437 8:119916717-119916739 CATTAAGCTGAATCACAGCAAGG + Intronic
1048099846 8:131339013-131339035 AATTAGTATGAGGCAGAGCATGG - Intergenic
1050939853 9:11444917-11444939 AATTATGCAGATGCAGAGCATGG + Intergenic
1051474588 9:17491197-17491219 AATTAAGCTGAGCCTGTGCTCGG + Intronic
1052859826 9:33430769-33430791 AATTCAGATGAGAGAGGGCAGGG - Intergenic
1055372404 9:75614096-75614118 AAAGAAACTGAGACACAGCAAGG + Intergenic
1055619751 9:78112071-78112093 AACTAAAATGAGAAAGAGCATGG + Intergenic
1056590068 9:87959734-87959756 AAGGAAGCTGAGGCAGAGAAAGG + Intergenic
1056730106 9:89158377-89158399 AATTAAAGTCATACAGAGCATGG - Intronic
1058307646 9:103463521-103463543 ATTTCAGCTGAGACAAGGCAAGG + Intergenic
1058698993 9:107585562-107585584 ATTGAGGCTGAGAGAGAGCAGGG + Intergenic
1060093901 9:120769802-120769824 ACTGAAGCTGAGACAGGGTAGGG - Intronic
1060251109 9:121987453-121987475 CATTCAGCTGTGACAGTGCAGGG - Intronic
1060292230 9:122314576-122314598 AATGAATCTGGGACAGAGCCAGG + Intronic
1060427446 9:123518512-123518534 CATTTAGCTGAGCCAGAGTAGGG - Intronic
1186259768 X:7765001-7765023 AAGTAAACTCAGAAAGAGCATGG - Intergenic
1187652876 X:21429607-21429629 AATTAACCTGAGGCTGGGCATGG + Intronic
1187982256 X:24770219-24770241 TATGAAGGTGAGACAGACCATGG + Intronic
1190441300 X:50476977-50476999 AGTGAAGCTGAGAAAGAGAAAGG - Intergenic
1191128990 X:56988357-56988379 AATTAAGCTTAGTGAGAACAAGG + Intronic
1192005955 X:67212638-67212660 CCTTAGGCTGAGACAAAGCAAGG - Intergenic
1194298560 X:92157254-92157276 AGTTAAGGTGAGGCAGAACAGGG - Intronic
1195999863 X:110770854-110770876 AATTAACCTGAGACTGGGCGTGG + Intronic
1197503405 X:127270493-127270515 AATTAAGTGGAGAAAGAACAAGG - Intergenic
1197952331 X:131911005-131911027 AATGACCCTGAGGCAGAGCAAGG - Intergenic
1198661257 X:138970288-138970310 AATTAAGCGGAGGAAGAGGAGGG + Intronic
1199225966 X:145374688-145374710 AATTATGTTAAGACAGAGCTTGG + Intergenic
1199574089 X:149296536-149296558 AATTAATGTGACACAGAGCCAGG - Intergenic
1199827938 X:151517644-151517666 AATGAAACAGAGACACAGCAGGG - Intergenic
1200616172 Y:5382216-5382238 ATTTAAGGTGAGGCAGAACAGGG - Intronic
1201279866 Y:12332378-12332400 AATTATTCTGAGACAGAAAAGGG - Intergenic