ID: 972751262

View in Genome Browser
Species Human (GRCh38)
Location 4:41991067-41991089
Sequence CCGCGGAGGTGAGTAACCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 38
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 37}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972751262_972751269 8 Left 972751262 4:41991067-41991089 CCCGCGGTTACTCACCTCCGCGG 0: 1
1: 0
2: 0
3: 0
4: 37
Right 972751269 4:41991098-41991120 TGCGGACTCCGCAAAGTTCCAGG 0: 1
1: 0
2: 0
3: 3
4: 38
972751262_972751266 -10 Left 972751262 4:41991067-41991089 CCCGCGGTTACTCACCTCCGCGG 0: 1
1: 0
2: 0
3: 0
4: 37
Right 972751266 4:41991080-41991102 ACCTCCGCGGTTGGAAATTGCGG 0: 1
1: 0
2: 0
3: 1
4: 42
972751262_972751270 9 Left 972751262 4:41991067-41991089 CCCGCGGTTACTCACCTCCGCGG 0: 1
1: 0
2: 0
3: 0
4: 37
Right 972751270 4:41991099-41991121 GCGGACTCCGCAAAGTTCCAGGG 0: 1
1: 0
2: 0
3: 9
4: 48
972751262_972751272 16 Left 972751262 4:41991067-41991089 CCCGCGGTTACTCACCTCCGCGG 0: 1
1: 0
2: 0
3: 0
4: 37
Right 972751272 4:41991106-41991128 CCGCAAAGTTCCAGGGTCTTTGG 0: 1
1: 0
2: 0
3: 8
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972751262 Original CRISPR CCGCGGAGGTGAGTAACCGC GGG (reversed) Intronic