ID: 972752370

View in Genome Browser
Species Human (GRCh38)
Location 4:42004533-42004555
Sequence GCATTCTGTATTATTTCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 278}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972752366_972752370 17 Left 972752366 4:42004493-42004515 CCTCTCTATCGTATTTTCTATTT 0: 1
1: 0
2: 6
3: 39
4: 467
Right 972752370 4:42004533-42004555 GCATTCTGTATTATTTCCTCAGG 0: 1
1: 0
2: 3
3: 28
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972752370 Original CRISPR GCATTCTGTATTATTTCCTC AGG Intronic
900759096 1:4458950-4458972 GAGTTCAGTATTATTGCCTCTGG + Intergenic
903873308 1:26453387-26453409 GCATTTTTTATTGTTTCCTCAGG + Intronic
905145750 1:35885580-35885602 GTTTTGTGTATTATGTCCTCAGG - Intronic
907554689 1:55333989-55334011 TCATTCTGAATCCTTTCCTCTGG + Intergenic
908026036 1:59952461-59952483 GCATTCTGTATGTTGTCTTCTGG - Intergenic
908179259 1:61587951-61587973 GCTTTCTGGATTTATTCCTCTGG + Intergenic
910304404 1:85746009-85746031 TCATTCTGTATTATTTCTTTTGG - Intronic
910363730 1:86441490-86441512 GCTTTCAGTAGAATTTCCTCTGG + Exonic
910389806 1:86729028-86729050 GCATTCTCTATTCTTTCCCAAGG - Intronic
911249689 1:95560728-95560750 GAATTCTGTAGAATTTGCTCAGG - Intergenic
911439082 1:97902495-97902517 GCATCCTGTAATCTTTCCTATGG - Intronic
913355634 1:117918736-117918758 TCATTCTTTATTGTTTCTTCAGG - Exonic
915618648 1:157063549-157063571 GTAATGTGTATTTTTTCCTCTGG + Intergenic
915658748 1:157383345-157383367 GGATTCTGTATCATATCCTGAGG - Intergenic
918336480 1:183519833-183519855 TAATACTGTATTATTTCCTGAGG + Intronic
918940988 1:190996356-190996378 AAATTCTGTATTATTTCCCTTGG - Intergenic
920065298 1:203264972-203264994 GGATTCTGTACTATTTTGTCAGG + Intronic
920968365 1:210720975-210720997 GCAACCAGTATTACTTCCTCTGG + Intronic
923935709 1:238757449-238757471 GGATTCAGAATTATTTACTCCGG - Intergenic
1063051046 10:2447909-2447931 GCATTCACTTTTTTTTCCTCGGG - Intergenic
1063351278 10:5357949-5357971 CCATTCTCTGTTATTTCCTTTGG - Intergenic
1063700866 10:8384187-8384209 TGATTCTGTTTTATTTCCACAGG + Intergenic
1064294809 10:14069121-14069143 GCCTTCTGTGTTATATTCTCAGG + Intronic
1065671507 10:28124032-28124054 AAAATCTGTATTATTTCCTCAGG + Exonic
1065904154 10:30233807-30233829 TCATGGTGGATTATTTCCTCAGG - Intergenic
1066036283 10:31490074-31490096 TAATTATATATTATTTCCTCTGG + Intronic
1066569665 10:36757084-36757106 GCATTCTTAATAATATCCTCAGG - Intergenic
1067404858 10:46012362-46012384 GCATTCTTGATTAGTTCCTTAGG - Intronic
1069032139 10:63608520-63608542 GCATTATGGATTAGTTTCTCTGG + Intronic
1069305915 10:66969492-66969514 GTATCTTGGATTATTTCCTCGGG + Intronic
1069348203 10:67495053-67495075 GCATTCTGTATTATTTTATCTGG + Intronic
1069376464 10:67798101-67798123 GCATCCATTATTATTTCCTTAGG - Intronic
1069512473 10:69052654-69052676 GCATGCTGTAGAATTTCCTTAGG + Intergenic
1070336549 10:75460640-75460662 ACATTATGGATTATTTCCTTTGG - Intronic
1070362683 10:75706305-75706327 ACATTTTGTATTATTTCCTTAGG + Intronic
1070848564 10:79543840-79543862 GCATGCTGTATTCAATCCTCTGG - Intergenic
1070925223 10:80216345-80216367 GCATGCTGTATTCAATCCTCTGG + Intergenic
1071300599 10:84253463-84253485 GCATTCTGTCCTATTTCTCCAGG - Intronic
1072086925 10:92088856-92088878 GCATTTTTTATTATTTCCAAGGG - Intronic
1073088888 10:100915709-100915731 GCACTCTGTACTAATTCCTTGGG + Intronic
1074873262 10:117594605-117594627 GCATTCTCTACAATTTCCCCAGG - Intergenic
1075019680 10:118942548-118942570 TCATTTTGGATTATTTCCTCAGG - Intergenic
1076442003 10:130486395-130486417 ACATTCTGAACTATTTCCCCTGG - Intergenic
1076984519 11:225659-225681 GCATTCTGGGTAATTTCTTCTGG - Intronic
1081019172 11:37921970-37921992 ACATTCTGTTGTATTTTCTCAGG + Intergenic
1086077779 11:82872787-82872809 GCCTTCTGTATTAGTTTCTTAGG - Intronic
1086140935 11:83499400-83499422 GCATTTTGGATTATTTTCTTGGG + Intronic
1086367860 11:86125996-86126018 GCATTATGTATTAATTTCTAAGG + Intergenic
1087694957 11:101366128-101366150 GTATTCTCTCTTATTTCCTTGGG + Intergenic
1087716032 11:101610005-101610027 CCATTCTGTTCTATTTCCTATGG - Intronic
1087822417 11:102727382-102727404 GCAATCTGTGTCATCTCCTCGGG - Intergenic
1088825938 11:113494708-113494730 GCATCCTGAATTATTCCCTCAGG + Intergenic
1089026591 11:115277019-115277041 CCATTCTGTATTTTGCCCTCGGG - Intronic
1090861402 11:130655975-130655997 GAACCCTGTATTTTTTCCTCTGG - Intergenic
1091179565 11:133591468-133591490 GCATTATGTTGTCTTTCCTCAGG + Intergenic
1091182602 11:133620269-133620291 GTATTATTTATTATTTCCTCTGG - Intergenic
1093310257 12:17573262-17573284 TCATTCTGTTTTGTTTCCTGTGG - Intergenic
1094443384 12:30503831-30503853 GTTTTCTGTTTTCTTTCCTCAGG + Intergenic
1095715446 12:45341312-45341334 GCATCCATTATTGTTTCCTCAGG - Intronic
1095760542 12:45829851-45829873 GCATTCTGGGTAATTTCCTTAGG + Intronic
1097042167 12:56162326-56162348 GCATTCTGTGTTCTTACCTGTGG - Intronic
1099503157 12:83438817-83438839 CCATTCTATATTATTCCTTCTGG + Intergenic
1100764683 12:97850590-97850612 GAATTTTGTATTTTATCCTCAGG - Intergenic
1101050165 12:100854566-100854588 GCATTCTGCATGATTTTCCCAGG + Intronic
1101181999 12:102229241-102229263 GGTTTCTGTCCTATTTCCTCTGG - Intergenic
1101229726 12:102727759-102727781 GGACTCTGTATTAATTCCTCAGG + Intergenic
1101495938 12:105254160-105254182 CCAAGCTGTATTCTTTCCTCTGG + Intronic
1102314665 12:111877561-111877583 GCCTTCTGTATATTTTCTTCGGG + Intronic
1104468213 12:129007089-129007111 GCTTTCTATTTTATTTCCCCTGG - Intergenic
1104557582 12:129815258-129815280 GCATTCTGGATTTTTTTCTGTGG - Intronic
1105485260 13:20823632-20823654 GAATTCTGTGTAATTTCCACAGG - Intronic
1105909161 13:24844846-24844868 GCATTTTGTATTTTTTTCCCTGG + Intronic
1108213538 13:48161514-48161536 GCCCTCTGTAAGATTTCCTCAGG + Intergenic
1109295242 13:60522874-60522896 ACATTCTGTTTTTTTTCCTCTGG + Intronic
1109484683 13:63002729-63002751 ACCTTCTGAATTATTTTCTCTGG - Intergenic
1109532691 13:63672094-63672116 TCATTTTATTTTATTTCCTCTGG - Intergenic
1112550246 13:100413043-100413065 GCATTCTGTTTTTTAGCCTCTGG - Intronic
1112905169 13:104408788-104408810 GCCATCTGTATTTTTTCTTCAGG - Intergenic
1113920088 13:113902625-113902647 GCATTTTGAATTATTTCCGTTGG - Intergenic
1114414019 14:22527310-22527332 TTATTCTGATTTATTTCCTCTGG + Intergenic
1114721134 14:24882914-24882936 ACATTCACTATTATTTTCTCAGG - Intronic
1114849176 14:26362038-26362060 GAATTCTGGATTATTTCTTTTGG + Intergenic
1115037004 14:28870006-28870028 GTATTGAGGATTATTTCCTCGGG + Intergenic
1115818204 14:37185860-37185882 GCCTTCTGTATTATCTTCTTTGG - Intergenic
1116476321 14:45344604-45344626 TCATTCTGCATTGTTTCATCTGG + Intergenic
1117018474 14:51544294-51544316 AAATTCTGTATTATTTCTTATGG + Intronic
1118011803 14:61617360-61617382 GCATCCTGTAAAATGTCCTCAGG + Intronic
1118089000 14:62451451-62451473 GCATTCTTTATTGTGGCCTCAGG + Intergenic
1118611557 14:67544804-67544826 GCATTCTGGATGATTTCCTTAGG - Intronic
1118714470 14:68549143-68549165 GCTGTCTGTCTTATCTCCTCAGG + Intronic
1119205454 14:72790714-72790736 GCATTCTGCCTCATTGCCTCTGG + Intronic
1120603771 14:86545849-86545871 GCCATCTGTCTTCTTTCCTCAGG - Intergenic
1121944320 14:98104661-98104683 TCATTCTGTTTCACTTCCTCAGG - Intergenic
1122068055 14:99187380-99187402 GCATTCTTTATTATTTCCAGTGG - Intronic
1123502175 15:20898288-20898310 GCATTCTTTATTTTTTCATATGG - Intergenic
1123595659 15:21909271-21909293 GCATTCTTTATTTTTTCATATGG - Intergenic
1126556865 15:49998117-49998139 TCATTTTGAATTACTTCCTCAGG + Intronic
1126855156 15:52831635-52831657 GTATTTTGGATTATTTCCTTAGG + Intergenic
1127187688 15:56496448-56496470 GAATTCTGGACTATTCCCTCTGG - Intergenic
1127639077 15:60898353-60898375 TCTTTCTGTATAATTTTCTCAGG + Intronic
1127670597 15:61190800-61190822 GCATTCTGTAATATACCCACTGG - Intronic
1127871496 15:63077618-63077640 GCATGCTCTATAATTTTCTCAGG + Intergenic
1130692300 15:86093414-86093436 CCATCATGTATTATTTCTTCTGG - Intergenic
1132225579 15:100138561-100138583 GCATTCTGGATAATTTCTTCAGG - Intronic
1132390827 15:101437059-101437081 GCATGATGTCTTTTTTCCTCTGG + Intronic
1202967771 15_KI270727v1_random:199131-199153 GCATTCTTTATTTTTTCATATGG - Intergenic
1133086431 16:3367285-3367307 AAAGTCTGTATTATTTCCACTGG + Intronic
1134607967 16:15586151-15586173 GCATTCTGTGTAACTTTCTCAGG - Intronic
1138071831 16:54000006-54000028 GCATGCTGGATCCTTTCCTCTGG - Intronic
1140136963 16:72215053-72215075 GTATTTTTTATTATTTCCTTTGG - Intergenic
1143289030 17:5814947-5814969 TGATTCTTGATTATTTCCTCAGG + Intronic
1144392182 17:14804013-14804035 GAATTCTTTGTTATATCCTCTGG + Intergenic
1144401687 17:14909490-14909512 TCATTCTCTATTACTTCTTCTGG - Intergenic
1144649009 17:16995624-16995646 ACATTTTGGATTATTTCTTCTGG - Intergenic
1145102264 17:20086898-20086920 GCATTCTATTCTATTTCCTCTGG - Intronic
1149137592 17:53388016-53388038 GCATTCTTTATTTATTCCTATGG + Intergenic
1149653251 17:58292264-58292286 GTTTACTGTATTTTTTCCTCTGG + Intergenic
1149692598 17:58590413-58590435 GCATTTTGGATTATTTCCTCAGG - Intronic
1151072073 17:71226140-71226162 GTATTTAATATTATTTCCTCAGG + Intergenic
1151217887 17:72590424-72590446 ACATTTTGTATTATTTTCTTTGG - Intergenic
1151753771 17:76058798-76058820 ACATTCTTGATTATTTCCTTAGG - Intronic
1155286236 18:24292246-24292268 GAATTCTGTTTTATTTTCTGAGG - Intronic
1155460255 18:26071827-26071849 TCATTCTTTTTTTTTTCCTCTGG - Intronic
1156095041 18:33520013-33520035 GCAATATGCATTTTTTCCTCTGG - Intergenic
1156510930 18:37635968-37635990 GCATGCTGTATTGTTTCCTATGG - Intergenic
1156760099 18:40578325-40578347 GCTGTCTGTAGTATTTTCTCAGG - Intergenic
1157015359 18:43706016-43706038 GCATTCTGCATTGCTTTCTCAGG + Intergenic
1157750220 18:50171833-50171855 TCTCTCTGTATTCTTTCCTCTGG - Intronic
1157984509 18:52421700-52421722 GCATTCTTGATTAATTCCCCAGG + Intronic
1158135797 18:54206784-54206806 GAATCCTGTACTCTTTCCTCTGG - Intronic
1158313672 18:56187181-56187203 CTATTCTGGGTTATTTCCTCTGG - Intergenic
1158378611 18:56903075-56903097 GCATTGTGTATTAATGCCTTGGG + Intronic
1159075247 18:63673991-63674013 GAATTCTGTATTTTGTTCTCCGG + Intronic
1159362806 18:67427158-67427180 ACATTGTGTATTTTTCCCTCAGG - Intergenic
1161002311 19:1916896-1916918 GCATTTAGTATCATTCCCTCCGG - Intronic
1164510411 19:28891901-28891923 GCATTCTATTTTTTTTCCTGTGG + Intergenic
1167489586 19:49784126-49784148 GCCTTCTGTTTTATTTCTGCTGG - Intronic
1168052803 19:53842212-53842234 GGATTTTGTTTTATTTCCTGTGG + Intergenic
924973091 2:149067-149089 GCATACAATATTTTTTCCTCAGG - Intergenic
925782459 2:7394445-7394467 GTATTCTGTAGGATCTCCTCTGG + Intergenic
925825788 2:7847212-7847234 TCATTCTGAATGATTTCCACAGG - Intergenic
927625100 2:24707856-24707878 GCCTCCAGTTTTATTTCCTCAGG - Exonic
928873323 2:36007316-36007338 GCATTCTAAAATATTTCCTACGG - Intergenic
930195348 2:48504322-48504344 GTATTCTAAATAATTTCCTCTGG - Intronic
931914753 2:66941916-66941938 TCATTTTGTCTTATTTCCTGAGG + Intergenic
933093506 2:78149015-78149037 GTATTCTGGATAATTTCTTCTGG + Intergenic
933702577 2:85266234-85266256 GCATCCTTAATTATTTCCTTAGG + Intronic
934166491 2:89298769-89298791 CCATTGAGTATTATTTCCCCGGG + Intergenic
937828188 2:126390438-126390460 GCATGCTGTAGTTTTTTCTCTGG - Intergenic
937980129 2:127609827-127609849 GCCTTCTGTCTTGTTTCCCCAGG + Exonic
938641775 2:133288705-133288727 GCATGCTGTTTCATTACCTCAGG + Intronic
940162217 2:150725683-150725705 TTATTCTGTCTTGTTTCCTCTGG - Intergenic
940449446 2:153818843-153818865 CCAGTCTGTAATATTCCCTCAGG + Intergenic
943091651 2:183382590-183382612 GCATTCTGGCTTCTTACCTCTGG - Intergenic
943252361 2:185543263-185543285 CCATTTTGTATTATTTCCCATGG - Intergenic
943533587 2:189118659-189118681 TCTTTCTGCATTATTCCCTCTGG + Intronic
943593838 2:189831547-189831569 GGATGCAGTATTATTTCCTTAGG - Intronic
943991747 2:194704314-194704336 TCATTCTATATGATTTTCTCTGG - Intergenic
944536378 2:200714158-200714180 GCATTCTATATTAATTTCTCAGG - Intergenic
945005886 2:205405467-205405489 GCATTGTGTCATATTTCCTGTGG + Intronic
946656071 2:221949213-221949235 AAATTCTGTATTATTTCATTTGG + Intergenic
947558604 2:231123625-231123647 ACAATCTGTTTCATTTCCTCTGG + Exonic
947706174 2:232277427-232277449 TCATTTTGGATTATTTCCTTAGG + Intronic
947973518 2:234344440-234344462 GCATACTGTATTAATTCCCAAGG + Intergenic
1169989090 20:11480288-11480310 GGATTCTCTATTTTTTCCACTGG - Intergenic
1170287765 20:14730176-14730198 GCTTTCTCTATGCTTTCCTCTGG - Intronic
1171335844 20:24384730-24384752 GCATTCGGCATTGTTTCCTTGGG - Intergenic
1172383901 20:34519238-34519260 ACTTTCTATATTATATCCTCTGG - Intronic
1173526025 20:43733340-43733362 CCAGTCTGTAGTATTTCCTTAGG + Intergenic
1174017978 20:47504295-47504317 GAATTCTATTTTATTTGCTCGGG - Intronic
1174445575 20:50588578-50588600 GAGTTCTGAATTATTTCCTTAGG - Intronic
1177623983 21:23635255-23635277 GCATTCTGTAATATATTCACAGG - Intergenic
1177761898 21:25411674-25411696 CCATTCTGAGTTATTTCCTGAGG + Intergenic
1177769072 21:25494401-25494423 GTATTTTGTTTTATTTCTTCTGG + Intergenic
1177790060 21:25713396-25713418 GCCTTCTGGATGATTTTCTCAGG + Intronic
1178496803 21:33093200-33093222 ACATGCCTTATTATTTCCTCAGG - Intergenic
1179106721 21:38407150-38407172 ACATCCTCTATTATTTCCTTAGG - Intronic
1179107309 21:38413952-38413974 GCATGCTGTATTATTTTCCTAGG + Intronic
1179364300 21:40741719-40741741 ACATTCTGATTTATTTCATCTGG - Intronic
1179729448 21:43359486-43359508 GAAATCTATTTTATTTCCTCAGG - Intergenic
1181086938 22:20444602-20444624 GTATTTTGGATTATTTCCTTAGG - Intronic
1184305648 22:43599592-43599614 TTATTCTGAATTATTTCTTCGGG + Intronic
1184814007 22:46856859-46856881 GCATTTTGGATAATTTCCTTGGG + Intronic
949274654 3:2264713-2264735 ATGTTCTGTATCATTTCCTCTGG + Intronic
949623387 3:5841735-5841757 GGATTCTGAATTATTTATTCAGG + Intergenic
950141200 3:10617170-10617192 ACATTTTGGGTTATTTCCTCAGG + Intronic
950258749 3:11528504-11528526 GCATTTTGTATTGTGTCCTCTGG - Intronic
952632580 3:35487400-35487422 GCATTCTGTATTACTTTCCCAGG + Intergenic
952756476 3:36872807-36872829 GCATTCTGTTTTCTTAGCTCAGG - Intronic
955814954 3:62832525-62832547 GTATTCTCTACAATTTCCTCTGG - Intronic
957141740 3:76368443-76368465 ACCTTCTGTATTATTTCTTGAGG - Intronic
957830316 3:85508184-85508206 GTTTTCTGTATTATATCCTTTGG + Intronic
959815413 3:110668530-110668552 ATATTCTGTTTTATTTCCTGTGG - Intergenic
962137428 3:132750785-132750807 GCATTTTGGATTATTTCTTTTGG + Intergenic
962545445 3:136429427-136429449 TCATCCTCTATTAGTTCCTCTGG - Intronic
963741000 3:149081313-149081335 GCATTCTTTATTTTTAACTCTGG - Intronic
963982344 3:151552672-151552694 GCATCCTCTCTTATCTCCTCAGG + Intergenic
965174294 3:165310962-165310984 TCATTTTTTATTATTTCCTGAGG - Intergenic
965246657 3:166280034-166280056 GCCTTCTGTATTATTTTCTAGGG - Intergenic
967647306 3:191941130-191941152 ACATTCTGTATTATTAGCTAAGG - Intergenic
968580528 4:1389989-1390011 GTAATCTTTATTATTTCCTTTGG + Intergenic
969243014 4:5913749-5913771 GCTTTCTGTATTCTTTCCCTTGG - Intronic
970151397 4:13094324-13094346 ACATTGTGTATTAGTTCCTTAGG - Intergenic
970247721 4:14080800-14080822 GAATTTTGAATTCTTTCCTCTGG + Intergenic
970657697 4:18249813-18249835 GCATTCTCTATCATTGTCTCAGG + Intergenic
972752370 4:42004533-42004555 GCATTCTGTATTATTTCCTCAGG + Intronic
973210394 4:47608782-47608804 CAATTCTGTATAAATTCCTCTGG - Intronic
973599636 4:52529207-52529229 CCATTCTGTAGTATTTGCTGTGG + Intergenic
973609613 4:52623032-52623054 GGATTCTCTGTTTTTTCCTCTGG - Intronic
973662802 4:53125304-53125326 CCCTTCTGTATTCTCTCCTCAGG - Intronic
973784346 4:54321168-54321190 GCCTTCTTTATTCTTCCCTCTGG + Intergenic
974579333 4:63775227-63775249 GCATTTTGTTTAATTTCTTCAGG - Intergenic
975706763 4:77119716-77119738 GCATTCTATATAATTTCCTCAGG + Intergenic
978329550 4:107597864-107597886 GCAATTAGCATTATTTCCTCAGG + Intronic
978937579 4:114396903-114396925 GCTTTCTGTATTATTTTATAGGG - Intergenic
979672791 4:123378482-123378504 TTATTCTGTTTTATTTCTTCCGG + Intergenic
991426998 5:66502724-66502746 GCATTCTGGGTAATTTTCTCTGG + Intergenic
992861407 5:80914460-80914482 GCATTCTTTCTTGTATCCTCAGG - Intergenic
994401997 5:99292127-99292149 GCACTATGTATGTTTTCCTCTGG - Intergenic
995795819 5:115940518-115940540 GCAAAATGTATTATTTCCCCTGG - Intergenic
997178995 5:131808599-131808621 GCATTATTTATAAGTTCCTCTGG + Intronic
997906243 5:137820278-137820300 GTATTTTGGATTATTTCCTGAGG + Intergenic
1000835524 5:166149059-166149081 AAATTCTGAATTATTTCCTAGGG + Intergenic
1004933776 6:20487841-20487863 CCATTGTTTATTATTGCCTCTGG - Intronic
1005972524 6:30772494-30772516 GCATCCTGTGTTAGGTCCTCTGG + Intergenic
1006415455 6:33901078-33901100 GCGTTCTGTATTATTTCTGTTGG - Intergenic
1007046095 6:38775598-38775620 GTCTTCTGTTTTATCTCCTCTGG + Intronic
1007411847 6:41668403-41668425 GCCATCTGTATTTTTTCTTCGGG - Intergenic
1007778146 6:44235350-44235372 GGATTCTGTATTTCTTCCTGAGG + Intergenic
1008681249 6:53875196-53875218 GCATTCCTGATTATTTCCTTAGG - Intronic
1010622822 6:78098644-78098666 ATTTTCTGTATTATTTCCACTGG - Intergenic
1010740266 6:79494823-79494845 TAATCATGTATTATTTCCTCAGG + Intronic
1011185837 6:84674558-84674580 GCATTGTTTATTATTAGCTCAGG - Intergenic
1012305082 6:97645617-97645639 GAAATCTGTATTATTTTCTATGG + Intergenic
1012559243 6:100558806-100558828 TCATTCCATATTATGTCCTCTGG + Intronic
1014486435 6:122004562-122004584 CCTTCCTGTATAATTTCCTCAGG + Intergenic
1014994811 6:128128676-128128698 GAATTCTGTATTCTTTCTTCTGG - Intronic
1015975446 6:138785894-138785916 ACATTTTGTGTTATTTACTCAGG + Intronic
1016259411 6:142149984-142150006 GCATTCTGTGTAATTTCTTGAGG + Intronic
1016822666 6:148361227-148361249 GCCATCTGTATTGTTTCCTAGGG - Intronic
1017380223 6:153820005-153820027 TCTTGCTGTATTATTTTCTCTGG + Intergenic
1017695111 6:157007042-157007064 ACATTTTGGATTATTTCCTTAGG - Intronic
1019307249 7:341616-341638 GCATTCTGTCCTGTCTCCTCGGG - Intergenic
1020079403 7:5279198-5279220 GCATTTAGAAATATTTCCTCAGG + Intronic
1020157056 7:5735602-5735624 GCGTTCTGGATGATTTCTTCAGG - Intronic
1020191182 7:5999223-5999245 GCATACTGTATCATTTCAGCAGG - Exonic
1020794842 7:12666765-12666787 ACATGCTGTATTATTTCCCCAGG + Intergenic
1022898774 7:34781079-34781101 GCCTTCTCTATTTTTTCCTTAGG - Intronic
1024353486 7:48391895-48391917 CCATGCTGTCTTATTTTCTCTGG + Intronic
1025199493 7:56953001-56953023 GCATTTAGAAATATTTCCTCAGG - Intergenic
1025672453 7:63623929-63623951 GCATTTAGAAATATTTCCTCAGG + Intergenic
1025849459 7:65234228-65234250 TCATTCTGAATTATTTCTTATGG + Intergenic
1025959877 7:66210513-66210535 GGATTCTGTATCATTTGGTCTGG + Intronic
1026255125 7:68704534-68704556 GCAATATGTATTATTTTCTCTGG + Intergenic
1030309755 7:108057373-108057395 ACATTCTGAATGATTTTCTCTGG - Intronic
1031515935 7:122698665-122698687 GCATTTTGGATTTTTCCCTCTGG + Exonic
1032029896 7:128474343-128474365 TCATTCTGGATTATTGCCTTAGG - Intergenic
1032812399 7:135433764-135433786 GCATTCTGTATTGATTCCCATGG - Intronic
1035138429 7:156731313-156731335 CCATTCTCTCTTATTTCCTTAGG - Intronic
1037495276 8:19434585-19434607 GCATTCTGAATTGTTTACTGGGG - Intronic
1037576620 8:20211209-20211231 CCAGTCTGAATCATTTCCTCTGG - Exonic
1038783107 8:30585533-30585555 GCAAACTGTATTCTTTTCTCTGG - Intronic
1038850775 8:31274141-31274163 GCATTTTGGATTATTTCCTTAGG - Intergenic
1039271258 8:35883161-35883183 GTATTGTGTATTATGTCCTTTGG + Intergenic
1039340608 8:36645597-36645619 GCATTTTTTATTATATCCTATGG + Intergenic
1042179245 8:66068833-66068855 GTAATATGTATTTTTTCCTCTGG - Intronic
1042590896 8:70397711-70397733 TCTTTTTGTTTTATTTCCTCTGG - Intronic
1043576084 8:81658723-81658745 GCATTCTGTACTTTTGCTTCAGG - Intronic
1043662696 8:82764950-82764972 TAATTCTGCAGTATTTCCTCAGG - Intergenic
1045143704 8:99315605-99315627 ATATTCTGAATTATTTCCCCAGG + Intronic
1045282282 8:100759452-100759474 GCAATCTATATTTTTTCCCCTGG + Intergenic
1046501186 8:115079153-115079175 GTAATCTGTATTTTTTGCTCTGG + Intergenic
1046953553 8:120040900-120040922 GCTTTCTGTATCATTTAATCGGG + Intronic
1050273208 9:3968358-3968380 GCTTTCTGTATTATTTAATTAGG - Intronic
1051012541 9:12436056-12436078 GCATTCTCTTCTATTTCCTTAGG + Intergenic
1051191961 9:14522551-14522573 ACCTTCTCTAGTATTTCCTCTGG - Intergenic
1054970370 9:71079338-71079360 GCATTCTGTGCTGTTCCCTCAGG + Intronic
1057965224 9:99496754-99496776 GAATTCATTATTAATTCCTCTGG + Intergenic
1058416130 9:104790294-104790316 ACATCTTTTATTATTTCCTCAGG - Intronic
1058531362 9:105908341-105908363 GGCTTCTGTATTATTCCTTCTGG + Intergenic
1059744965 9:117191153-117191175 CTATTCTGTGTTATTTCCTCAGG - Intronic
1060431085 9:123551955-123551977 GCATTCTGAATTTTTTCATTAGG + Intronic
1062154932 9:135042387-135042409 GCATTCTGTGTTAGTTCCCTAGG + Intergenic
1185495110 X:548769-548791 CCATTCTTATTTATTTCCTCAGG + Intergenic
1185814144 X:3138514-3138536 ACATTCTGAATTATTTCTTTTGG + Intergenic
1186034531 X:5407079-5407101 GCATTTTGAATAATTTCCACTGG - Intergenic
1186319205 X:8405834-8405856 ACATTATGTATAACTTCCTCTGG + Intergenic
1189000429 X:36938282-36938304 GCATTCTGGATTATGGCATCTGG + Intergenic
1189307651 X:39998996-39999018 GCATTCTGTATCATTCACTTGGG - Intergenic
1190755573 X:53398854-53398876 GCATTTTGGATGATCTCCTCAGG + Intronic
1190852681 X:54261871-54261893 GCATTCTTAATTATTTCCTTAGG + Intronic
1191636306 X:63381234-63381256 ACATACTTTCTTATTTCCTCGGG - Intergenic
1192265903 X:69538112-69538134 GCCTTCTGTGTTTTTACCTCAGG - Intergenic
1192634401 X:72804166-72804188 GCAGTCTGTAGAATTACCTCAGG + Intronic
1192647309 X:72916635-72916657 GCAGTCTGTAGAATTACCTCAGG - Intronic
1193291015 X:79772534-79772556 GCATACTGTTTTATTTCCTGTGG + Intergenic
1194284220 X:91989600-91989622 ACATTCTGTATTGTTTCCTTTGG - Intronic
1194560942 X:95419461-95419483 GTCTTCTGTATCATCTCCTCTGG + Intergenic
1194686205 X:96920486-96920508 GAGTTATGTATTATTACCTCTGG + Intronic
1195028061 X:100898299-100898321 GAGGTCTGTATTGTTTCCTCTGG - Intergenic
1196003972 X:110815738-110815760 ACCTTGTGTATGATTTCCTCAGG - Intergenic
1196282753 X:113842280-113842302 GCAATCTGTGTTATTAGCTCTGG - Intergenic
1197541738 X:127771692-127771714 CCATTCTGTATCCTTACCTCAGG + Intergenic
1200325078 X:155229551-155229573 TCATTCTGTGTGATTTCCTCTGG + Intronic
1200601786 Y:5214158-5214180 ACATTCTGTATTGTTTCCTTTGG - Intronic
1201267562 Y:12222968-12222990 ACATTCTGAATTATTTCTTTTGG - Intergenic
1202171887 Y:22058267-22058289 GCACTCAGTTTTTTTTCCTCAGG - Intergenic
1202219475 Y:22528105-22528127 GCACTCAGTTTTTTTTCCTCAGG + Intergenic
1202323703 Y:23667976-23667998 GCACTCAGTTTTTTTTCCTCAGG - Intergenic
1202547068 Y:26002078-26002100 GCACTCAGTTTTTTTTCCTCAGG + Intergenic