ID: 972755171

View in Genome Browser
Species Human (GRCh38)
Location 4:42039245-42039267
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4611
Summary {0: 1, 1: 0, 2: 1, 3: 114, 4: 4495}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972755171 Original CRISPR AAATATACAGAGAATGAGCA TGG (reversed) Intronic
Too many off-targets to display for this crispr