ID: 972761635

View in Genome Browser
Species Human (GRCh38)
Location 4:42111479-42111501
Sequence GGTGGGTCATGAAGCTTTCA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 140}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972761635_972761644 23 Left 972761635 4:42111479-42111501 CCTTGAAAGCTTCATGACCCACC 0: 1
1: 0
2: 1
3: 16
4: 140
Right 972761644 4:42111525-42111547 AGTGCAAGCCAGGACCCTCATGG 0: 1
1: 0
2: 0
3: 10
4: 141
972761635_972761645 29 Left 972761635 4:42111479-42111501 CCTTGAAAGCTTCATGACCCACC 0: 1
1: 0
2: 1
3: 16
4: 140
Right 972761645 4:42111531-42111553 AGCCAGGACCCTCATGGCCTTGG 0: 1
1: 0
2: 0
3: 24
4: 282
972761635_972761641 13 Left 972761635 4:42111479-42111501 CCTTGAAAGCTTCATGACCCACC 0: 1
1: 0
2: 1
3: 16
4: 140
Right 972761641 4:42111515-42111537 GTTCCCAAGAAGTGCAAGCCAGG 0: 1
1: 0
2: 1
3: 13
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972761635 Original CRISPR GGTGGGTCATGAAGCTTTCA AGG (reversed) Exonic
905657170 1:39692310-39692332 AGCGGGTCTGGAAGCTTTCAGGG + Intronic
907308392 1:53526040-53526062 GCTGGGGCTTGAAGCTTACAAGG + Intronic
907593892 1:55702093-55702115 GGTGGGGAAAGAAGCTATCAAGG + Intergenic
907866183 1:58401411-58401433 GGTGGGTCTTAAAGATGTCAAGG - Intronic
908360672 1:63366329-63366351 GGTGGGTGATGAAGCTGGAAAGG - Intergenic
909686017 1:78349622-78349644 GGTGGGCCTTGCAGCTTTCAGGG + Intronic
913218003 1:116636638-116636660 GGTGAGTCATGCAGCTTTTCAGG - Intronic
915890141 1:159765713-159765735 TGTGGGTCATGTAGATTTCGAGG + Intergenic
917460193 1:175222749-175222771 GGTGGGTGATGAGGCTATTATGG + Intergenic
921315032 1:213882323-213882345 TGTGGGTCAAGGAGCTCTCAAGG + Intergenic
922029734 1:221786370-221786392 GGTGGGAGATGCATCTTTCAGGG - Intergenic
1062927082 10:1325265-1325287 GGTGCGGCATGAAGTTGTCATGG - Intronic
1063946694 10:11183093-11183115 GGTGCATGAGGAAGCTTTCAGGG - Intronic
1063981965 10:11461042-11461064 GGTGGGGCTTTAAACTTTCAAGG - Exonic
1064472708 10:15653252-15653274 GGTAGATCATGAAGGTCTCAGGG - Intronic
1064508053 10:16055396-16055418 GATGGGTCAAGAAGCTTATATGG - Intergenic
1064642598 10:17429549-17429571 GGTGGGAGTTGAAGATTTCATGG - Intronic
1065190468 10:23203723-23203745 GGTAGGTCATGAAGACTACAGGG - Intergenic
1065355453 10:24835856-24835878 TTTGGGTCTTGATGCTTTCAGGG - Intergenic
1067144646 10:43686299-43686321 GGTGGGTCAGGAAGCAGTTATGG + Intergenic
1069932525 10:71892284-71892306 GTTGGGTCATGAAACAGTCAAGG - Intergenic
1070819933 10:79348608-79348630 GGTGGGTCTTGCAGCTTCGAGGG + Intronic
1070847950 10:79539241-79539263 GATGGGTCCTGATGCTCTCAGGG + Intergenic
1077306979 11:1872890-1872912 GGTGGGTCATGAAGCTCAGGGGG + Intronic
1080026198 11:27617657-27617679 GGAGCATCATGGAGCTTTCAAGG + Intergenic
1082630544 11:55537270-55537292 GCTGGGTCATGCAGCCTTCAAGG - Intergenic
1085299855 11:75451438-75451460 GCTGGGTCACGGAGCTTTGAAGG + Intronic
1090488922 11:127140688-127140710 TGTGGATCTTGAAGCTCTCATGG + Intergenic
1091194147 11:133717716-133717738 AGTGGCTCATGAAGCTTCCAGGG - Intergenic
1091434809 12:464072-464094 GCTGGGTCGTGAAGCTGTCCTGG + Intronic
1091522887 12:1265694-1265716 GGTGGGGCATGATACTTTAAGGG - Intronic
1092025364 12:5235020-5235042 GGTGGGTGATGGGGATTTCAGGG - Intergenic
1092240528 12:6833559-6833581 GGTGGGTGATGATGCTTTTCTGG + Intronic
1092583519 12:9874055-9874077 GGAGGGTCATGATCCTTTCTTGG - Intergenic
1098330765 12:69350343-69350365 GGTCCCTCATGAACCTTTCAAGG - Intronic
1099760106 12:86910288-86910310 AGTGGGTCATGAATTTTACAGGG + Intergenic
1103578943 12:121899889-121899911 GGTGGGTCAGGTAGCCTTCGGGG + Intronic
1105501927 13:20980405-20980427 GATGGGTCATGAGGCTCTGAAGG - Intronic
1106272269 13:28166416-28166438 GGTGGGTCCTGAAGGCTTCAGGG + Intronic
1110936296 13:81293862-81293884 GCTTGGTCAGGAAGCTTTCAAGG + Intergenic
1111211857 13:85089891-85089913 GTTGGTTCATGAAGCTTTAGGGG - Intergenic
1111437968 13:88236966-88236988 GGTGGGTTATGATGTATTCATGG - Intergenic
1112733537 13:102394079-102394101 GGCGGGTCCTGAAGTTTTCTGGG - Intronic
1113696707 13:112351487-112351509 GGTTGGTTATGCAGCTTTGAAGG + Intergenic
1114892490 14:26942830-26942852 GGTGGATTGTGAAGATTTCATGG - Intergenic
1116892841 14:50285586-50285608 GGTAGGTAAGGAAGTTTTCATGG - Intronic
1117381986 14:55173678-55173700 CGTGGATTATGAAGATTTCATGG + Intronic
1117415789 14:55494223-55494245 CGTGGATTATGAAGATTTCATGG + Intergenic
1120314684 14:82876024-82876046 GGTGGGTCTCTAAGGTTTCAGGG - Intergenic
1121033134 14:90676294-90676316 GGTGGGTTATGGAACTCTCATGG + Intronic
1121232517 14:92368291-92368313 GAAGGGTCATGAAGCTTTCCTGG - Intronic
1121459592 14:94064624-94064646 GGTAGGGCATGGAGTTTTCATGG - Intronic
1121586035 14:95063755-95063777 GGTGAGTCCTGAAGTGTTCAGGG + Intergenic
1122083676 14:99284801-99284823 GGTTGGTTGTGAAGCTTCCAGGG - Intergenic
1122111735 14:99508259-99508281 GGTTGCTCATGAAGCATTTATGG + Exonic
1125145094 15:36457793-36457815 GGTGGTTCTTGAAGTTTTCTGGG - Intergenic
1125675808 15:41502075-41502097 GGTGGATCCTGAAGCTCCCACGG + Exonic
1131193805 15:90338772-90338794 GATGGGTCATGATGCTTTTGTGG + Intergenic
1131552892 15:93373128-93373150 GGCGGGTCATGCTGCTTTCATGG + Intergenic
1133162013 16:3918100-3918122 GGTGGATTGTGAAGATTTCATGG + Intergenic
1135573160 16:23564936-23564958 GGTGAGTAAGGAGGCTTTCAAGG - Intronic
1136517617 16:30777436-30777458 GGAGGGTCAGGAAGCTTTCCGGG - Intergenic
1138230226 16:55331124-55331146 GGGAGGTCAGGCAGCTTTCAGGG + Intergenic
1140620566 16:76726010-76726032 CATGGCTCATGAAGCTCTCAGGG + Intergenic
1143998218 17:11027603-11027625 GCTGGTTCCTGAAGCGTTCAGGG + Intergenic
1145208398 17:20996486-20996508 AGTGCCTCATGAAGCTTTCCTGG + Intergenic
1152047655 17:77948566-77948588 GGTGAGTTAGGAAGCTGTCACGG - Intergenic
1157427637 18:47597694-47597716 CGAGGGTCATGAAGTCTTCAAGG + Intergenic
1157922611 18:51728903-51728925 TGTTGGTCATAAAGCCTTCAAGG - Intergenic
1158337053 18:56423726-56423748 GGTGAATCATAAAGCTGTCAAGG + Intergenic
1158592485 18:58789511-58789533 GTTGGGTCAGGAGGCTTTCTGGG + Intergenic
1158648260 18:59266009-59266031 GGACGGGCATGAGGCTTTCAGGG - Intergenic
1159304363 18:66620710-66620732 AGTGGTTCATCAGGCTTTCAGGG - Intergenic
1165224031 19:34341565-34341587 GCTGGTACATGAAGCTTTCTTGG - Exonic
1165414839 19:35686517-35686539 GGTGGGGCGAGAAGCTTTCCGGG - Intergenic
925031529 2:653717-653739 GGTGTTTCAAGAAGCTGTCAAGG - Intergenic
926006878 2:9379308-9379330 GGTGGGTCTTGCAGCTCTCACGG + Intronic
926129198 2:10290333-10290355 GGTGGGTCCCGAAGCTGTGAGGG + Intergenic
928267132 2:29821536-29821558 GGTTGGTCTTGGACCTTTCAGGG - Intronic
928327040 2:30327854-30327876 GGTGGGACATGTAGCATCCATGG + Intergenic
929862058 2:45687147-45687169 GTTGGTCCATGAAGCTTTCATGG - Intronic
931812927 2:65872570-65872592 GGTGGATCAGGAAGGCTTCAGGG + Intergenic
932851728 2:75194232-75194254 GATGGGTCATTTAGATTTCAGGG - Intronic
938026779 2:127956232-127956254 GAAGGGACATGAAGCTTCCATGG - Intronic
938706237 2:133930008-133930030 GGTGGGTCAGGGAGCCTTCGTGG - Intergenic
938728492 2:134127564-134127586 GGAGTGTCATGGAGCTCTCATGG + Intronic
940994169 2:160128961-160128983 GGTGGTACTTGAAGCTGTCATGG + Intronic
942871259 2:180737006-180737028 GGTGGCTCAAGAAGATGTCAAGG - Intergenic
943824240 2:192368652-192368674 GGTGGGGCTTGAAGCCCTCAAGG - Intergenic
944323541 2:198376869-198376891 AGTGAGTCATGAAGGTATCAGGG - Intronic
945060060 2:205900886-205900908 GTTGGGTAGTGAAGCTTCCAAGG + Intergenic
946686419 2:222276340-222276362 GGTGGGAAATGAAGCCTTCTGGG - Intronic
1169195205 20:3679162-3679184 TGTGGGTCCTGAAGCTTTTCAGG - Intronic
1169209721 20:3759286-3759308 GGTGGGTCTGGAAGCTTCCTTGG - Intronic
1170693895 20:18639962-18639984 GTTGGGTCATGAAACCTTCAGGG + Intronic
1172221787 20:33279242-33279264 GATGGCTCTTGAAGCTTTCAAGG - Intronic
1172264441 20:33598819-33598841 GGTGGATTGTGAAGATTTCATGG - Intronic
1173677094 20:44845442-44845464 GGCTGGTCATGAAACTTTTAAGG + Intergenic
1174068585 20:47883709-47883731 GCTGGGTCTCGGAGCTTTCATGG + Intergenic
1174264145 20:49319106-49319128 GGGGGGTCGTGAAGCTTGGAGGG + Intergenic
1180203189 21:46239626-46239648 GGTGTCTAATGAAGATTTCAAGG + Intronic
1180819304 22:18814722-18814744 GGTGAGTCATGCAGCTTTTCAGG - Intergenic
1181205529 22:21249167-21249189 GGTGAGTCATGCAGCTTTTCAGG - Intergenic
1203221394 22_KI270731v1_random:46246-46268 GGTGAGTCATGCAGCTTTTCAGG + Intergenic
1203269432 22_KI270734v1_random:40575-40597 GGTGAGTCATGCAGCTTTTCAGG - Intergenic
951470728 3:23053157-23053179 GCAGGGTCTTGAAGGTTTCATGG - Intergenic
955969094 3:64419233-64419255 GGTGAGTGAGGATGCTTTCAGGG - Intronic
965057822 3:163744574-163744596 GCTGTGTCATGAGGCTGTCAAGG + Intergenic
967833852 3:193944351-193944373 GCTGGGTCCTGACGCTCTCAGGG - Intergenic
967871917 3:194236827-194236849 GGTGGGACAGGAAGATTTGAGGG - Intergenic
968902641 4:3438722-3438744 GTTGGGTCTAGAAGCTTCCAAGG + Intronic
971987613 4:33846523-33846545 GGTGGATTGTGAAGATTTCATGG - Intergenic
972569801 4:40300231-40300253 CGTGGGGCATGCAGCTTTGAAGG + Intergenic
972761635 4:42111479-42111501 GGTGGGTCATGAAGCTTTCAAGG - Exonic
975949216 4:79747776-79747798 GGTGGCTAATGAAGCTTTCAGGG - Intergenic
979905946 4:126293182-126293204 CGTGATTCATGAATCTTTCAGGG - Intergenic
980490777 4:133525206-133525228 AGTGGCTGATGTAGCTTTCAAGG + Intergenic
983078829 4:163359759-163359781 GGTGGGTGATGAAGGGTTTATGG + Intergenic
987583337 5:19823431-19823453 TGTGGATTATGAAGATTTCATGG - Intronic
987638917 5:20585600-20585622 GGTGGGACCAAAAGCTTTCATGG + Intergenic
995066319 5:107867327-107867349 GCTGGGTCATGTGGCTGTCAGGG + Intronic
996631869 5:125642686-125642708 GCAGGGTCATAAAGCTCTCAAGG - Intergenic
1001589937 5:172858303-172858325 GGTGTTTTATGCAGCTTTCATGG - Intronic
1007204717 6:40139501-40139523 GGTATGTCATCTAGCTTTCAGGG - Intergenic
1010320622 6:74504701-74504723 GGTGGGTCTAGAAGCATTCTTGG - Intergenic
1012734708 6:102924338-102924360 GGTGAGTCAGAAAGCTTTCAAGG + Intergenic
1013564338 6:111342270-111342292 GGAGGGTCAGGAAGCTTACTTGG + Intronic
1015454141 6:133405869-133405891 GCTGGGTCATGCAGCTGTCTGGG + Intronic
1018940070 6:168303333-168303355 GGTGGGTCCTGGAGGTTTCTGGG + Intronic
1019726334 7:2604889-2604911 GGTGCTTCAGGCAGCTTTCAGGG + Exonic
1020803568 7:12761051-12761073 CGTGGATTATGAAGATTTCATGG - Intergenic
1026610478 7:71855297-71855319 CGTGTTTCATGAAGCTTTCCAGG + Intronic
1026669867 7:72380593-72380615 GCTAGGACATGAAGCTTGCAGGG - Intronic
1029262159 7:99310243-99310265 GGTGGGGGATGAAGCTAGCAGGG + Intergenic
1033557397 7:142500590-142500612 GGTGGGGCCTGCAGCTCTCAAGG - Intergenic
1035882523 8:3257764-3257786 GGTGGATGATGAGGCTTCCAAGG + Intronic
1037472499 8:19224382-19224404 GGTTGGGCATAAAGGTTTCAAGG + Intergenic
1038450243 8:27634714-27634736 GGTGGGTCAGGCAGGGTTCAGGG - Intronic
1042664641 8:71192105-71192127 GTTGGGTCATAAAGATTTCATGG + Intergenic
1044106109 8:88209239-88209261 GGTTGGTCATGCTGTTTTCAAGG - Intronic
1044271190 8:90246076-90246098 AGTGGGTCATGAAGATTTTCAGG + Intergenic
1048906954 8:139097634-139097656 GATGGGACATGAAGATTACAAGG + Intergenic
1049529388 8:143146862-143146884 GGGGGGTCGTGCAGGTTTCACGG - Intergenic
1052970312 9:34373291-34373313 AGAGGGTCAGGAAGCTTTCCAGG + Intronic
1053183198 9:35992028-35992050 TGGGGGTCAGGAAGCTGTCAAGG + Intergenic
1053184474 9:36003600-36003622 TGGGGGTCAAGAAGCTGTCAAGG + Intergenic
1053185572 9:36013419-36013441 TGGGGGTCAGGAAGCTGTCAAGG - Intergenic
1054794429 9:69286634-69286656 GGTGGGGTATGAACCTATCATGG - Intergenic
1057703076 9:97377598-97377620 GGAGGGTCACACAGCTTTCAGGG - Intronic
1062322749 9:135998384-135998406 GGTCAGTCAGGAAGCTTTGAGGG - Intergenic
1186213037 X:7270270-7270292 GATGTGTCATTCAGCTTTCAAGG + Intronic
1189465853 X:41277006-41277028 GGTGGGGCAGGGCGCTTTCAGGG - Intergenic
1191254362 X:58273424-58273446 GATGGGTGACCAAGCTTTCACGG - Intergenic
1192752284 X:74005739-74005761 CGTGGATCGTGAAGATTTCATGG - Intergenic
1193698799 X:84739742-84739764 GGAGGATCATGATGCTTTCAGGG - Intergenic
1194984606 X:100477042-100477064 TATGGGTCATCAAGCTTTCAGGG + Intergenic
1196667771 X:118334039-118334061 TTGGGGTTATGAAGCTTTCAAGG - Intergenic
1198447660 X:136734261-136734283 GGTGGTTCATAAGGCTTTCCTGG + Intronic