ID: 972762204

View in Genome Browser
Species Human (GRCh38)
Location 4:42117783-42117805
Sequence TGGTTTTTGCAGAAGATGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 267}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972762204 Original CRISPR TGGTTTTTGCAGAAGATGAC AGG Intronic
900206285 1:1433261-1433283 AGGCTTCTGCAGAAGATGAAGGG - Intergenic
903613042 1:24630933-24630955 TGGTTTTTGAAAAATATGATTGG - Intergenic
906130880 1:43454805-43454827 TGGTGTTGCCAGAAGGTGACTGG + Intergenic
906855195 1:49296882-49296904 TTGCTTTTGCAGAAGATAATAGG + Intronic
907323599 1:53620938-53620960 TGGTTTATCAAGAAGCTGACTGG + Intronic
907597345 1:55732128-55732150 AGTTATCTGCAGAAGATGACAGG - Intergenic
907724055 1:57002285-57002307 TGGTCTTTGCAGCAGATCATTGG - Intronic
910181601 1:84490369-84490391 TGTTTATTACAGAAGAGGACTGG + Exonic
910817338 1:91305187-91305209 TAGTTTTTGCAGAAATTCACAGG - Intronic
916106331 1:161435329-161435351 AGTTATTTGCAGAAGATGGCAGG + Intergenic
919214806 1:194538631-194538653 CGATTTTGGCAGAAGATGAGGGG + Intergenic
920786556 1:209047841-209047863 TGCTTTTTGCAGCAGTTGAAGGG + Intergenic
921960777 1:221031615-221031637 TGGTTTTTGCAGAAGTGGGATGG - Intergenic
922299825 1:224288477-224288499 TGCTTTGTGGAGAAGATGAAAGG + Intronic
922781048 1:228252583-228252605 AGTTATCTGCAGAAGATGACAGG + Intronic
924118625 1:240773534-240773556 TGGTTTATGCAAAAGCAGACAGG + Intergenic
1068168080 10:53357331-53357353 TGGTTTTGGAAGGAGATGAATGG + Intergenic
1068408750 10:56627056-56627078 TGGTTTGTGAAGAAGCTGAATGG - Intergenic
1068644442 10:59450262-59450284 TGGATTTTGCTGAAGATCATAGG + Intergenic
1071365915 10:84900484-84900506 TGGTTTTTGTAGTAGACAACTGG + Intergenic
1073746726 10:106477749-106477771 TTGTTTTTTCTGAAGATGTCAGG + Intergenic
1074989866 10:118694918-118694940 TGGTTTTTGCAGAACCTGTGAGG - Intronic
1075967916 10:126628770-126628792 TGGTTTCTGCAGAAGCTGCAGGG - Intronic
1076463424 10:130661742-130661764 TGGTTCTTGCAGAAGTTGTGAGG - Intergenic
1076819839 10:132932712-132932734 GGGTCTTTGCAGAAACTGACAGG + Intronic
1077513085 11:2981858-2981880 TGTATTCTGCAGAAGGTGACGGG - Intronic
1077513403 11:2984617-2984639 TGTATTCTGCAGAAGGTGACGGG - Intronic
1078040398 11:7856252-7856274 TAGTTTTTGAACTAGATGACTGG - Intergenic
1078429310 11:11275699-11275721 TGATTTTTGTAGAAGATGTAAGG + Intronic
1079288429 11:19162510-19162532 TGGTTTTAGAAGAAAATGAGAGG + Intronic
1080122707 11:28695797-28695819 TGGTCTTTGCACAAGATCATTGG - Intergenic
1082999658 11:59279854-59279876 TAGTATCTGCAGAAGATGGCAGG - Intergenic
1083261609 11:61526070-61526092 TGGCTGGTGCAGAAGATGAAGGG + Intronic
1088891380 11:114047413-114047435 TGGTTTATGCAGAAGTTTCCAGG + Intergenic
1089125423 11:116173117-116173139 TGGTGTTTGCAGTTGATGAATGG + Intergenic
1090437275 11:126697225-126697247 TTGTTTATGCGGGAGATGACAGG + Intronic
1091253410 11:134163156-134163178 GGGTTTATTCAGAAGATGACAGG + Intronic
1093372149 12:18378156-18378178 TGGTCTTGACAGAAGATGAGGGG - Intronic
1094138541 12:27155211-27155233 TGGATTTAGCAGAAGATAAAAGG + Intergenic
1094248735 12:28334314-28334336 TGGTTTTTGAAGAGGAAAACGGG + Intronic
1095308752 12:40669757-40669779 TGGGCTTTGCAGAAGGAGACAGG - Intergenic
1095311393 12:40701756-40701778 TGGTTTCTGCACAAGTTGAGTGG + Intronic
1097577147 12:61409137-61409159 TGCTTTGTGCACCAGATGACTGG - Intergenic
1097586085 12:61517925-61517947 TGGTTGTTTCTGATGATGACTGG - Intergenic
1098749845 12:74279564-74279586 AGTTATCTGCAGAAGATGACAGG - Intergenic
1099835900 12:87909619-87909641 TTGTTTTTGTAGAAGATGTTGGG + Intergenic
1100036849 12:90262154-90262176 TGGTTTTAGCAGAATTTGAATGG - Intergenic
1100822179 12:98441878-98441900 AGGTTTTTGCAGAGTAGGACTGG + Intergenic
1101264129 12:103066095-103066117 AGTTATCTGCAGAAGATGACAGG - Intergenic
1105464188 13:20621953-20621975 TGGCTTTTCCAGAATATCACAGG + Intronic
1105757112 13:23476743-23476765 TTTTTTTTGCAGAAATTGACAGG - Intergenic
1106774128 13:32991918-32991940 TGGGTTTTGAAGAAGAAGATGGG + Intergenic
1107983578 13:45755999-45756021 AGTTATCTGCAGAAGATGACAGG + Intergenic
1108018730 13:46103225-46103247 TGGTTGTTGCAGAGGTTGGCGGG - Intronic
1108904275 13:55449944-55449966 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1110410381 13:75198272-75198294 TGGTTTGTGGAGAAGAAAACTGG + Intergenic
1110419710 13:75292368-75292390 TGTATTTTGCAGAAGAAAACTGG + Intronic
1110834138 13:80064656-80064678 TGTTATCTGCAGAAGATGGCAGG + Intergenic
1111298221 13:86311461-86311483 TGCTTCTGGCAGAAGAGGACTGG + Intergenic
1112126456 13:96473666-96473688 TGGCTTTTGCAGATGATGGATGG + Intronic
1113307881 13:109097490-109097512 GGGTTTCTGCAGAAGAAGAAAGG - Intronic
1114153140 14:20068047-20068069 TGATTTTTGTATAAGATGAAAGG - Intergenic
1115059714 14:29173867-29173889 AGTTATCTGCAGAAGATGACAGG - Intergenic
1116415069 14:44669285-44669307 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1117048329 14:51835488-51835510 GGGTTTTTGCTGAAGTTGAGAGG - Intronic
1117310019 14:54511895-54511917 TGGGTTAGGCACAAGATGACTGG - Intronic
1118505647 14:66408069-66408091 TGGTTTGTGCAGTAGTTGAATGG - Intergenic
1119383613 14:74243746-74243768 TGCTCTTTGCAGAAAATGACTGG - Intronic
1120053364 14:79894310-79894332 TGGTGTTTGCTGTAGATCACTGG + Intergenic
1122368199 14:101210364-101210386 TGGGTTTTGCAGACATTGACAGG - Intergenic
1125038774 15:35158756-35158778 TGGTTTTAGCAAAAGATTACTGG + Intergenic
1125380746 15:39084167-39084189 TGGTTGGTGTAGAAGATGAGCGG - Intergenic
1125718424 15:41833113-41833135 TTGTATTTTCAGAAGATGACTGG + Intronic
1125992669 15:44124875-44124897 TGGATTGAGCAGAAGAGGACGGG + Intronic
1126203741 15:46019134-46019156 TGGTTGGTTCAGAAGAAGACAGG + Intergenic
1126442646 15:48707571-48707593 TGATTTTTGCACATGATGAGAGG + Intergenic
1127026029 15:54807729-54807751 TGTTTTGTGCAGTAGAAGACAGG - Intergenic
1127089536 15:55453294-55453316 AAGTTTTTGCAGAAGATTAGTGG + Intronic
1127933164 15:63611021-63611043 GGGTTCTTGGAGGAGATGACTGG + Intronic
1128136144 15:65265067-65265089 TGGGTTTTGCTAAGGATGACGGG - Intronic
1129860480 15:78856750-78856772 TGGTTGTTGCAGGAGCTGATGGG + Intronic
1132111178 15:99103264-99103286 TAGTTTTAGCAGAAAAGGACAGG + Intronic
1135596260 16:23745658-23745680 TGGTTTTTTACGAAGAAGACTGG - Intergenic
1135864522 16:26088940-26088962 TGGATTTTGCAGAATTTGAGAGG - Intronic
1140211235 16:72972248-72972270 AGGGTTTTGCAGAATTTGACTGG + Intronic
1140544813 16:75796962-75796984 TGATTTTTGTATAAGATGAGAGG + Intergenic
1141384699 16:83609359-83609381 TAGTTTTTACACAAGAAGACTGG - Intronic
1141505356 16:84473912-84473934 TGGTTTTTGTAGATGGTGAGAGG - Intergenic
1144319611 17:14101454-14101476 TGGGGTTTACAGAAGCTGACAGG - Intronic
1144436004 17:15241561-15241583 TAGTTTCTGCTGAAAATGACAGG - Intronic
1146769771 17:35557976-35557998 TGATTTTTGGAGAAGAAAACAGG - Exonic
1149122009 17:53180545-53180567 TGGTTTTTGTATAAGGTGAGAGG + Intergenic
1149210769 17:54297678-54297700 TGGATTTTGAGGAAGAAGACAGG - Intergenic
1149934845 17:60794570-60794592 TGATTTTTGCATAAGGTGAGAGG + Intronic
1150003019 17:61452919-61452941 TGGTGTTTGCAGAATATGCAAGG + Intronic
1150039238 17:61841041-61841063 TGGTTTTTGTAGATGGTGAGAGG - Intronic
1153696718 18:7650838-7650860 TGGTTTTTGTAGAAGGTGTAAGG - Intronic
1154073438 18:11176701-11176723 TGTTTTTTGCAGGAGATGTGGGG - Intergenic
1154091574 18:11368889-11368911 TGTTCTTAGCTGAAGATGACAGG + Intergenic
1154129891 18:11727520-11727542 CGGTTTAGGCAGAAGATGAGGGG - Intronic
1155999297 18:32367140-32367162 TGGGCTTTGCAGAAAATGAAAGG - Intronic
1156627688 18:38929296-38929318 TGGTTATGGCAGAAGATATCTGG + Intergenic
1157020097 18:43771165-43771187 TGGTGTTTGCTGGAGGTGACTGG - Intergenic
1157278335 18:46328362-46328384 TGGTTTTTGAAGAAAATGGTTGG + Intronic
1158173687 18:54628733-54628755 TGGGTTTTGAAGAAGATGGATGG + Intergenic
1158409132 18:57188994-57189016 AGCTTTTTGCAGAGGATGTCTGG - Intergenic
1158661737 18:59394847-59394869 TGGTTTTTAAAAATGATGACTGG - Intergenic
1160515622 18:79477932-79477954 TGGTGTTTGCAGGAGGTAACTGG - Intronic
1161802980 19:6426028-6426050 TGGTTTTTGCTGAACGTGTCTGG - Exonic
1164406689 19:27954428-27954450 TTGTTTGTGCACAACATGACAGG - Intergenic
1164487081 19:28667796-28667818 TGGTCTTTGCAGATAAGGACTGG + Intergenic
1164514605 19:28923054-28923076 TGAGTGTGGCAGAAGATGACCGG + Intergenic
1165721061 19:38080123-38080145 TGGTTACTGCAGACTATGACTGG - Intronic
925813210 2:7721699-7721721 TGATTTCTGCAGAGGAAGACAGG + Intergenic
926810399 2:16750706-16750728 TAGTATCTGCAGAAGATGGCAGG + Intergenic
926923957 2:17967754-17967776 TGTTTATTACAGAAGGTGACTGG - Intronic
929868369 2:45737282-45737304 TGATTTATCCAGAAGATGAGAGG - Intronic
931218533 2:60268039-60268061 TGGTCTCTGCAGAAGAATACCGG - Intergenic
931262148 2:60629719-60629741 TGGTCTGCACAGAAGATGACTGG - Intergenic
932355752 2:71067638-71067660 GGGTTTCTCCAGAAGATGGCAGG + Intronic
933265687 2:80178412-80178434 AGTTATCTGCAGAAGATGACAGG + Intronic
935425113 2:102911356-102911378 AGTTATTTGCAGAAGATGGCAGG + Intergenic
939591399 2:144067762-144067784 TGGTTTTACCAGAAGGTTACTGG - Intronic
939911923 2:147993497-147993519 TGCTTTTTGCATAAGCTGAAGGG - Intronic
940125882 2:150323782-150323804 TGATTTTTGTATAAGATGAGAGG + Intergenic
940397925 2:153213770-153213792 TGGATTTTTCTGAGGATGACAGG + Intergenic
941762170 2:169256154-169256176 TGGTTTAGACAGAAGAAGACTGG - Exonic
942227939 2:173832880-173832902 TGGTTTTTAGGGGAGATGACTGG - Intergenic
944324660 2:198389927-198389949 GGGTTTTTGCAAATGATGACTGG + Intronic
944865482 2:203856038-203856060 CGGTTTTTGGAGAAGTTGAAAGG - Intergenic
947318585 2:228892339-228892361 TGCTTGTTGGAGAAGAGGACTGG + Intronic
948053346 2:234994350-234994372 TGGTTCCTGCAGAGGATGAGTGG + Intronic
948669206 2:239556137-239556159 TTATTTTTGCAGAAATTGACAGG - Intergenic
948738673 2:240027677-240027699 TGGTTTATTCAGAAGATGCAAGG + Intergenic
1168924174 20:1566034-1566056 TGGAGTTTACAGAAGGTGACAGG - Intronic
1168947434 20:1773254-1773276 TGGTTTTTCCAGAAAACCACTGG - Intergenic
1170092312 20:12604140-12604162 AGGTATCTGCAGAGGATGACAGG + Intergenic
1170155376 20:13264386-13264408 TGGTGTTTGCAGAATAGGGCAGG + Intronic
1173838777 20:46142673-46142695 TGCTTTTTGCTGAGCATGACAGG + Intergenic
1175518734 20:59586040-59586062 TGGGTATTGGAGAAGATGTCCGG - Intronic
1177251681 21:18599632-18599654 TGATTTTTGTAGAAGATGTAAGG + Intergenic
1178660192 21:34501337-34501359 TGCTTCAGGCAGAAGATGACAGG + Intergenic
1183789610 22:40055409-40055431 TAGTATGTGGAGAAGATGACCGG + Intronic
1184948586 22:47822536-47822558 TGGTATTTGCAGAATATTAAGGG + Intergenic
1184990021 22:48161100-48161122 AAGGTTTTGCAGAAGATGACAGG + Intergenic
1185333716 22:50262430-50262452 TGGGTTTTGCAGGACAGGACAGG - Intergenic
949829949 3:8203403-8203425 TGGTTGTTGGAGAAGAAGAGTGG + Intergenic
950783132 3:15409608-15409630 TGTTTCTCGGAGAAGATGACTGG - Intronic
950828865 3:15854738-15854760 TGTTTTGTGCTGGAGATGACAGG - Intronic
951285782 3:20811589-20811611 TTTTTTTTGTAGAAGATGAATGG - Intergenic
953743021 3:45553260-45553282 TGTTTATTGCTGAAGATGATTGG - Intergenic
956703897 3:71982917-71982939 AGTTATCTGCAGAAGATGACAGG + Intergenic
957877329 3:86164662-86164684 TGGTTTCTGCTGAGTATGACAGG + Intergenic
962116155 3:132510261-132510283 AGATTTTTTTAGAAGATGACTGG + Intronic
962521071 3:136197428-136197450 TTGTTTTTGCAGGAGATCAAGGG + Intergenic
963177050 3:142309631-142309653 TGGAGTTTTCAGAAGATGGCAGG + Exonic
964050892 3:152392065-152392087 TTTTTTTTGCACAAAATGACAGG - Intronic
965178563 3:165368213-165368235 TAGTTTTTACAGATGATGAATGG - Intergenic
965295383 3:166938716-166938738 TGTTTTTTGCAGAACATGTATGG - Intergenic
966730138 3:183144030-183144052 TGTGTTTTGCAGAAGTGGACAGG - Intronic
966977195 3:185095194-185095216 TGATTTTTGCAGAGAAGGACAGG - Intronic
970546295 4:17133701-17133723 TGGTGAGTGCAGAAGAAGACCGG + Intergenic
970718882 4:18961331-18961353 TGGCTTTTGCAAGAGATGTCTGG + Intergenic
971857654 4:32062863-32062885 AGTTATCTGCAGAAGATGACAGG + Intergenic
971946281 4:33282542-33282564 TGGTTGTTGAAGAAAATGTCAGG + Intergenic
972391119 4:38614528-38614550 TGCTTTCTGCAGAAGAAAACTGG + Intergenic
972762204 4:42117783-42117805 TGGTTTTTGCAGAAGATGACAGG + Intronic
973120983 4:46520928-46520950 TGTTATTTGCAGAAGATGGCAGG + Intergenic
973554146 4:52065457-52065479 TGATTTTTGCATAAGGTGAGAGG + Intronic
974342355 4:60630611-60630633 TGATTTTTGCACAAGGTGAAAGG + Intergenic
975975484 4:80090689-80090711 TGGTTTATGAAGAGTATGACTGG + Intronic
976034208 4:80795851-80795873 AGTTATTTGCAGAAGATGGCAGG + Intronic
976698283 4:87941624-87941646 TGGTTTCTGCAGAAGATAAATGG + Intergenic
976952743 4:90852692-90852714 TGTTTTTTCCAGAAGAGGAAAGG + Intronic
977204714 4:94155654-94155676 AGTTATCTGCAGAAGATGACAGG - Intergenic
977430763 4:96928182-96928204 AGGTATCTGCAGAAGATGGCAGG - Intergenic
978278444 4:106979486-106979508 ATGATTTTGCACAAGATGACAGG - Intronic
979946634 4:126840567-126840589 TGTGTTTTGGAGCAGATGACTGG + Intergenic
981716318 4:147756194-147756216 AGGTATTAGCAGAAGCTGACTGG - Intronic
981971051 4:150662289-150662311 TGCTATTCGCAGAGGATGACAGG + Intronic
982390356 4:154857099-154857121 TGGTGTTGGCACAAGATGTCAGG + Intergenic
984198545 4:176689577-176689599 TGCTATTTGCAGAAGGTGATGGG - Intronic
984611588 4:181845654-181845676 TGGTCTTTGCACCACATGACTGG + Intergenic
984840013 4:184059698-184059720 TGGTTGTAACAGTAGATGACAGG - Intergenic
985781873 5:1875832-1875854 TTGTTTTTGCGGAAAATGCCTGG + Intergenic
986414731 5:7517222-7517244 GGGTTTCTGCAGAGGATCACAGG + Intronic
987596998 5:20014634-20014656 TGATTTTCTAAGAAGATGACTGG - Intronic
987902409 5:24029856-24029878 TGTTTTTTGCATAAGGTGAGAGG + Intronic
988729048 5:33951964-33951986 TGGCTGTAGCAGAAGATGAGTGG - Intronic
992109883 5:73482906-73482928 AGTTATCTGCAGAAGATGACAGG + Intergenic
992535714 5:77700896-77700918 TGATTTTTGTATAAGATGAGAGG - Intronic
993666304 5:90701167-90701189 TAGTTTTTGCCCAAGATGAAAGG - Intronic
995383842 5:111566755-111566777 TGATTTTTGCATAAGATGTAAGG + Intergenic
995427736 5:112043755-112043777 AGTTATTTGCAGAAGATGGCAGG + Intergenic
996202304 5:120691340-120691362 TGATCTTTGCAGAATATGAAAGG + Intergenic
996594798 5:125187962-125187984 AGTTTTTGGCAAAAGATGACTGG + Intergenic
996899473 5:128527770-128527792 TTGTTTTTTCAAAAGATCACAGG + Intronic
998651199 5:144123573-144123595 TTGTTTTTTCAGTAGATGATGGG - Intergenic
999587742 5:153109650-153109672 TAGTTTTTACAGGTGATGACTGG - Intergenic
1000223249 5:159234277-159234299 AGGTATCTGCAGAAGATGGCAGG + Intergenic
1001568924 5:172717666-172717688 TGGTTGCTGCAGCAGTTGACCGG - Intergenic
1003671144 6:8161559-8161581 TGCTTTTTACAGAAAATGAAGGG + Intergenic
1003909243 6:10728379-10728401 TGGGTTTTGCAGAAGACAAGTGG + Intronic
1003912471 6:10754885-10754907 TGGGTTTTGCAGAAGACAAGTGG + Intronic
1004516100 6:16323566-16323588 TGGTTTCTGCAGAGGCTGCCAGG + Intronic
1008255086 6:49288784-49288806 TGATTTTTGCATAAGGTGAGAGG + Intergenic
1009390114 6:63135106-63135128 AGTTATCTGCAGAAGATGACAGG + Intergenic
1011312243 6:85992246-85992268 TGCTTTTGGTAGAAGATAACAGG + Intergenic
1013569672 6:111409108-111409130 TTGTTTTTACAGAAGATAGCTGG + Intronic
1016082653 6:139874938-139874960 AGGTTGTTCCAGAAAATGACTGG + Intergenic
1017800864 6:157894957-157894979 TGGTGTGTGCTGAAGATGAAGGG + Intronic
1018012262 6:159681849-159681871 TGGTTTTTGCAGTAGGAGAAAGG - Exonic
1018349252 6:162939228-162939250 TGATTTTTGCATAAGGTGAGAGG - Intronic
1018781358 6:167069241-167069263 TGGTTTTTGTATAAGGTGAGAGG + Intergenic
1024299082 7:47872269-47872291 TTGTTTTTGCAGAAATCGACAGG + Intronic
1027400516 7:77801086-77801108 TGGATTTTGCTGAAGATAAAGGG + Intronic
1027761384 7:82283605-82283627 TGGTCTTGGAAGAAGATGATAGG + Intronic
1027935760 7:84600122-84600144 GGGTGTTTACAGAAGAGGACAGG + Intergenic
1029216389 7:98953518-98953540 TGGTTTTGGGAGAAGACAACAGG - Intronic
1030224711 7:107137232-107137254 TGGTTTGAACAGAAGATAACTGG + Intronic
1030368750 7:108673998-108674020 AGTTTTCTGCAGAAGATGGCAGG - Intergenic
1030616563 7:111743765-111743787 TGGGTTTGGCAGTAGCTGACAGG - Intronic
1031236824 7:119187986-119188008 AGTTATCTGCAGAAGATGACAGG - Intergenic
1036176572 8:6543869-6543891 TGGGCTTTGCAGAAGCTGAAAGG + Intronic
1037629259 8:20638097-20638119 TGGTTTGAGCAGAAAATGAAAGG + Intergenic
1039125578 8:34197562-34197584 TGGTTTATGCAGAAGAGTAGGGG - Intergenic
1039513347 8:38109529-38109551 TAGTGATTGCACAAGATGACAGG - Intronic
1040867559 8:52065129-52065151 TGGTTTTTGTATAAGGTGAAAGG + Intergenic
1040911943 8:52528388-52528410 TGTTATCTGCAGAAGATGGCAGG - Intergenic
1041209975 8:55539777-55539799 TTGTTTTTGCAGAAGAAAACTGG + Exonic
1041556219 8:59159412-59159434 TGGTTTTTGCAGCCTATTACAGG - Intergenic
1041934551 8:63321300-63321322 AGTTATCTGCAGAAGATGACAGG - Intergenic
1042644531 8:70971627-70971649 TGATTTTTGTATAAGATGAGAGG + Intergenic
1043259973 8:78184223-78184245 AGCTATCTGCAGAAGATGACAGG + Intergenic
1043331317 8:79121481-79121503 TGGTTTTTGAGGAAGAATACGGG + Intergenic
1043374346 8:79631683-79631705 TTGTCTTTGAAGAAGATCACAGG + Intronic
1044263807 8:90159338-90159360 TTGTTTTTGCTGATGATGAATGG + Intergenic
1044436336 8:92168179-92168201 TGTTTCATGCAAAAGATGACAGG - Intergenic
1046323155 8:112604613-112604635 TGGTTTTTGTATATGATGAAAGG - Intronic
1046585788 8:116147749-116147771 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1046883810 8:119340504-119340526 TGCATTTTGCAGAGGATGTCTGG - Intergenic
1048086117 8:131181779-131181801 TGGTTTTTGTATATGATGATCGG + Intergenic
1050182959 9:2939976-2939998 AGGTTTCTGCATTAGATGACTGG - Intergenic
1050892896 9:10847159-10847181 TGTTTTATGCAGAAGAAAACTGG - Intergenic
1050920154 9:11190123-11190145 TGATTTTTGCATAGGATGAAGGG + Intergenic
1050955320 9:11650351-11650373 TGTTGTTACCAGAAGATGACTGG - Intergenic
1051756180 9:20403175-20403197 TGAATTTTGCAGAAGAGAACTGG - Intronic
1052442272 9:28512312-28512334 AGTTATCTGCAGAAGATGACAGG + Intronic
1054934991 9:70677258-70677280 TGGTTTATGCAGAAGTTGCTAGG - Intronic
1055452852 9:76446309-76446331 GAGTTTTTGCAGAAGCTGATGGG + Intronic
1059843826 9:118248678-118248700 TGGTAGTTGCAGATGATTACAGG + Intergenic
1060451640 9:123747517-123747539 TTGGTTTTGCATAAGATCACTGG + Intronic
1062330652 9:136042545-136042567 TCGTTTTTGCAGAAGGGGTCAGG - Intronic
1186448080 X:9648943-9648965 TGGTTCTTGCAGAGGAATACTGG + Intronic
1187267920 X:17753547-17753569 TGGTTTTTAAAGAAGTAGACTGG - Exonic
1187863539 X:23703629-23703651 TTGTTTTTTCAGAAGATGGGAGG + Exonic
1189154887 X:38746752-38746774 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1189315133 X:40049890-40049912 TGATTTAAGCAGAAGAGGACTGG - Intronic
1190222146 X:48519044-48519066 TGGTTTTTGAAGCACATGATAGG - Intronic
1190471019 X:50779764-50779786 TGTGTTTTGCAGATGGTGACTGG - Intronic
1190774550 X:53542298-53542320 TGGTTTCTGTAAATGATGACAGG - Intronic
1191072294 X:56413485-56413507 TGATTTTTGTATATGATGACAGG + Intergenic
1191941263 X:66483896-66483918 AGTTATCTGCAGAAGATGACAGG + Intergenic
1193053487 X:77125736-77125758 AGTTTTCTGCAGAAGATGGCAGG - Intergenic
1193085175 X:77442462-77442484 TTTTTTTTCCAGAAGATGATTGG + Intergenic
1193832946 X:86310065-86310087 AGTTATCTGCAGAAGATGACAGG - Intronic
1194513420 X:94822284-94822306 AGTTATCTGCAGAAGATGACAGG + Intergenic
1195782357 X:108479897-108479919 AGTTTTTTGCAGAGGATGGCAGG + Intronic
1195807397 X:108790671-108790693 TGGTTTTTGCTGTATATCACAGG + Intergenic
1196040562 X:111198492-111198514 TGATTTTTGCATATGATGAAGGG + Intronic
1197002284 X:121452889-121452911 AGTTATCTGCAGAAGATGACAGG - Intergenic
1197380003 X:125727937-125727959 AGTTTTCTGCAGAAGATGGCAGG + Intergenic
1197591864 X:128419355-128419377 AGTTATCTGCAGAAGATGACTGG - Intergenic
1197628002 X:128824543-128824565 TAGTTTGAGGAGAAGATGACAGG + Intergenic
1199772992 X:150986039-150986061 TGTTCTTTGCAGACGATGTCCGG + Exonic
1200340497 X:155390672-155390694 AGTTATCTGCAGAAGATGACAGG + Intergenic
1200786026 Y:7261125-7261147 TGGGTTTTCCAGAAAAGGACTGG - Intergenic