ID: 972765154

View in Genome Browser
Species Human (GRCh38)
Location 4:42146097-42146119
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 486
Summary {0: 1, 1: 1, 2: 3, 3: 53, 4: 428}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972765154 Original CRISPR CAGGATTGGCTGGAGAAGGA GGG (reversed) Intronic