ID: 972765154

View in Genome Browser
Species Human (GRCh38)
Location 4:42146097-42146119
Sequence CAGGATTGGCTGGAGAAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 486
Summary {0: 1, 1: 1, 2: 3, 3: 53, 4: 428}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972765154 Original CRISPR CAGGATTGGCTGGAGAAGGA GGG (reversed) Intronic
900187469 1:1339106-1339128 CAGGATGGGCTGCACAAGGTGGG + Intronic
900190995 1:1352154-1352176 GAGGAGTGGCGGGAGCAGGAAGG - Intergenic
900427054 1:2585708-2585730 CTGGGCGGGCTGGAGAAGGAAGG - Intergenic
900686852 1:3954282-3954304 CAGGAGAGGCTGGAGCAGGGCGG - Intergenic
901184047 1:7360794-7360816 CAGGCGTGGCAGGAGAGGGATGG - Intronic
901749557 1:11397470-11397492 CAGGGTTGGCTGCAAGAGGAAGG - Intergenic
901812877 1:11777812-11777834 GAGGATGGGCTGGAGAGGGAGGG - Intronic
901818059 1:11806122-11806144 CAGGAGTGGCTGCAGACGGGTGG - Intronic
902045919 1:13524230-13524252 GAGGAAGGGCTGGGGAAGGATGG + Intergenic
902155622 1:14483283-14483305 CAGGGTTGCATGGAGGAGGAGGG - Intergenic
902242821 1:15100178-15100200 CAGGAGTGCCTGGAGAAAGAGGG + Intronic
902619908 1:17644724-17644746 CAGGTCGGGCTGGAGAAGCAGGG + Intronic
903036170 1:20494001-20494023 TAGGAGGGGCTGGGGAAGGAAGG + Intergenic
903367699 1:22815237-22815259 CAGGACAGGCTAGAGATGGAAGG + Intronic
903687486 1:25142537-25142559 CTGGAAAGGCTGGAGGAGGAAGG + Intergenic
904768820 1:32870107-32870129 CAGGAGAGGCTGGGCAAGGACGG + Intronic
904909454 1:33922876-33922898 ATGGATGGGCTGGAGGAGGAAGG - Intronic
905282968 1:36860685-36860707 CAGGGTGGGCTGGTGAAGGAAGG + Intronic
905349891 1:37338151-37338173 CAGGATTGGCAGGAGGAGAGAGG + Intergenic
905658929 1:39705510-39705532 CAGGATTGGGTAGAGTGGGAGGG - Intronic
905693682 1:39960246-39960268 CTGGATGGGCTGGAGATGAAAGG - Intronic
906220053 1:44071476-44071498 CAGGGAAGGCTGGAGAAGGAAGG - Intergenic
906605137 1:47164042-47164064 CAGCAGTGGCTGGAGGAGGCAGG - Intergenic
907039080 1:51241792-51241814 CAGGAAAGGCTGAAGAAGGGAGG + Intronic
907496139 1:54846031-54846053 CAGCAATCCCTGGAGAAGGAGGG + Intergenic
907652746 1:56311380-56311402 CAGGAGTTGCTGGAGAGGAAAGG - Intergenic
907862105 1:58363588-58363610 GGTGATTGGCTGCAGAAGGAAGG - Intronic
908183055 1:61625230-61625252 CATGATTGGGTGGGGAAGAAGGG - Intergenic
908245056 1:62221341-62221363 AAGGGTGGGGTGGAGAAGGAGGG - Intergenic
908263734 1:62358833-62358855 GAGGATTGGCTGGAGCTGAATGG + Intergenic
910096992 1:83534445-83534467 CAAGACTGGCTCCAGAAGGATGG - Intergenic
910100168 1:83567344-83567366 CAGGCTTGCCTGGAGCAGAAAGG + Intergenic
911272175 1:95815498-95815520 CAGGAGAGCCTGGAGAAGGAAGG + Intergenic
912865344 1:113251347-113251369 CACGAGTGACTGGAGAAGGGTGG - Intergenic
913474486 1:119223703-119223725 CAACATTGGCTGGAGAAGCTTGG + Intergenic
913547548 1:119884474-119884496 CAGCCTGGGGTGGAGAAGGAAGG - Intergenic
915167441 1:153956239-153956261 CAGGGAAGCCTGGAGAAGGAGGG + Intronic
915584773 1:156838491-156838513 CAGGTTGACCTGGAGAAGGAAGG - Intronic
916075390 1:161197498-161197520 CAGGAGTGGCAAGAGAGGGAGGG - Intronic
916893458 1:169136622-169136644 CATGAATGGCAGAAGAAGGAGGG - Intronic
917058743 1:171013466-171013488 CAAGAATGGCTGGGGAGGGAGGG - Intronic
917325117 1:173824291-173824313 CAGGCTCAGCTGGAGAGGGACGG - Exonic
917849352 1:179047274-179047296 CAGGATGGTCTGGAGGAGGGAGG - Intronic
919481583 1:198096624-198096646 GAGGGTAGGGTGGAGAAGGAGGG + Intergenic
919844918 1:201636023-201636045 CTGGATTGGCCAGAGAAGTAGGG - Intronic
919896451 1:202012454-202012476 CAAGACAGGCTGGGGAAGGAAGG - Intronic
922208170 1:223467084-223467106 AAGGATGAGCTGGAGAAGGCTGG - Intergenic
923456066 1:234166673-234166695 CAGGATAGGAGGGAGCAGGAAGG + Intronic
924261448 1:242235557-242235579 CAGGATTTGGGGGAGAAGGAGGG + Intronic
1063042258 10:2355566-2355588 CAGAATGTGCTGGATAAGGAGGG - Intergenic
1063046182 10:2394435-2394457 CAGAATCCGCTGGAGGAGGAAGG + Intergenic
1063199707 10:3776128-3776150 CAGGGCTGGCTGGGGAAGGTAGG + Exonic
1063440511 10:6069154-6069176 CAGGATAGCCTGGAGCACGAGGG + Intergenic
1066106943 10:32164848-32164870 CAAGATGGGATGAAGAAGGATGG - Intergenic
1066106980 10:32165033-32165055 CAAGATGGGATGAAGAAGGATGG - Intergenic
1067683956 10:48456421-48456443 CATGCCTGGCTGGAGATGGAAGG - Intronic
1070145557 10:73771309-73771331 CAGGATTAGCAGGAAAAAGAGGG - Exonic
1070755380 10:78988829-78988851 AAGGATGAGGTGGAGAAGGAAGG - Intergenic
1070946629 10:80397274-80397296 CAGGAGAGGCTGGAGAAGCTGGG + Intergenic
1070982415 10:80660216-80660238 CAGCCAGGGCTGGAGAAGGAGGG - Intergenic
1070982894 10:80664321-80664343 CAGGAAAGGCTGCAGAGGGATGG + Intergenic
1071412673 10:85412464-85412486 CAGCATTGGATGGAGAAAGCAGG - Intergenic
1071670688 10:87606662-87606684 CATGAATGGCTGGAGATGGTGGG + Intergenic
1072215431 10:93283673-93283695 CAGGCATGGCGGGAGAAGGAAGG + Intergenic
1074757469 10:116635119-116635141 CAGGGTGGGCTGGAGGGGGAAGG + Intronic
1074831724 10:117254315-117254337 CAAGGCTGGCTGGAGAGGGAAGG + Intronic
1075193236 10:120330577-120330599 CAGGTTTGGCTGGAGCAGAGTGG - Intergenic
1076071814 10:127496489-127496511 CAGGATTGGCTGGCTAAGAGGGG - Intergenic
1076374598 10:129974774-129974796 GTGGTTGGGCTGGAGAAGGAAGG - Intergenic
1076467033 10:130690027-130690049 TAGGCTTGGCTGGAGAAGCTTGG + Intergenic
1076806789 10:132862791-132862813 CAGGAGAGGCTGGAGGGGGACGG + Intronic
1077052073 11:571494-571516 CAGGGGTGGCTGGAGGAGGTGGG - Intergenic
1077093920 11:791441-791463 CAAGAGCGGCTGGGGAAGGACGG + Exonic
1077150592 11:1071345-1071367 CAGGGTTGGCTGTGGCAGGATGG + Intergenic
1077211930 11:1375159-1375181 CAGGCTGTGCTGGAGAAAGATGG - Intergenic
1078101355 11:8332167-8332189 CAGTGGTGGCTGGAAAAGGAAGG + Intergenic
1078153141 11:8776048-8776070 CAGGGCTGGCTGAAGAGGGAAGG - Intronic
1079330152 11:19526548-19526570 CAGGATTGGATGAAGAAGAAGGG + Intronic
1080776474 11:35391626-35391648 CAGGTTTGGTTGGGGAAGAAGGG + Intronic
1082187717 11:49204804-49204826 CAGGATTCGCTGGTGAATAAAGG - Intronic
1083273127 11:61581848-61581870 CAGGGTTGGAAGGAGAAGGAGGG - Intergenic
1083287005 11:61666530-61666552 CAGGACCGGCTAGAGGAGGAGGG - Intergenic
1083400995 11:62423546-62423568 CTGGGTTGGCTAGAGAAGGAAGG - Intergenic
1083737941 11:64692390-64692412 AAGCATGGGCTGGAGAAAGAGGG - Intronic
1083949793 11:65947608-65947630 CAGGACTCCCTGCAGAAGGAGGG + Exonic
1084600658 11:70143480-70143502 GAGGGATGGTTGGAGAAGGACGG + Intronic
1084793563 11:71489971-71489993 CGGGGTGGGGTGGAGAAGGACGG + Intronic
1085316597 11:75548811-75548833 CAGGATTGTGTGGCTAAGGATGG - Intergenic
1087059359 11:93962868-93962890 CACGATTGGCTTGAGAGGGCTGG + Intergenic
1087308013 11:96506800-96506822 CCGGACTTGGTGGAGAAGGATGG - Intronic
1088080547 11:105906691-105906713 CAGGAGTGGCAGGAGATGGATGG + Intronic
1088243804 11:107797304-107797326 CAGAATGGGCTAGGGAAGGAGGG + Intronic
1089289039 11:117426793-117426815 TGGGAAGGGCTGGAGAAGGAGGG - Intergenic
1089535149 11:119156475-119156497 GAGGATTGGCCTGAGATGGAGGG + Intronic
1089668480 11:120035337-120035359 CAGGATTATCTGCAGAAGGAAGG - Intergenic
1089806658 11:121096746-121096768 CAGTCTTGCCTCGAGAAGGATGG + Intergenic
1090465014 11:126925812-126925834 CAGGAGAGGATGGAGAAGGCCGG - Intronic
1091218800 11:133918917-133918939 AAAGACTGACTGGAGAAGGAAGG + Intronic
1091934169 12:4422342-4422364 CAGGGCTGGGTGGAGAAGGATGG + Intergenic
1093843296 12:23933216-23933238 CAGGGTTAGCTGGAGCAGGATGG - Intronic
1094140914 12:27181402-27181424 CAGGATGGGATGGGGAAGGGTGG + Intergenic
1094365087 12:29671805-29671827 CAACATGGGCTGGAAAAGGAAGG + Intronic
1095507128 12:42909711-42909733 CAGCATAGGAGGGAGAAGGAAGG - Intergenic
1095812547 12:46385469-46385491 CAGTCTTGGCTGGACAGGGAAGG - Intergenic
1096777411 12:53972803-53972825 CAGGATTGGGGGAAGGAGGAGGG - Intergenic
1097599823 12:61676832-61676854 ATGGATTGGCTGGAGAAAGCTGG - Intergenic
1099856287 12:88171361-88171383 CAGGGTTGGAGGGAGAAGGTTGG - Intronic
1100864621 12:98843700-98843722 CAGGGTGGGGTGGAGAAGCAAGG + Intronic
1104685220 12:130780508-130780530 CAGGAGTCGCTGGTGGAGGAGGG - Intergenic
1104856725 12:131905643-131905665 CAGGCTGGGCTGGAGGAGCAAGG - Intronic
1105450163 13:20492558-20492580 CAGGGTTGGCTGGCTATGGAGGG - Intronic
1107907295 13:45072877-45072899 CAGGGTTGGTTGGAGACAGAGGG + Intergenic
1108001302 13:45907790-45907812 CAGGCTGGGCTGGATACGGAAGG - Intergenic
1110836015 13:80083852-80083874 CAGAATTGGAGGGAGCAGGAGGG + Intergenic
1111102772 13:83609565-83609587 CAGGATTAGCAGGAGTATGAGGG + Intergenic
1111689514 13:91544877-91544899 CAGTCTTGGCTGGAGCTGGAGGG + Intronic
1112007957 13:95270473-95270495 CAGGAATGATGGGAGAAGGAAGG - Intronic
1113446459 13:110371959-110371981 CAGGAGTGGGTGGACAAGGCCGG + Intronic
1113467816 13:110524517-110524539 CAGCCATGGCTGGAGATGGAAGG + Intronic
1114186813 14:20408851-20408873 AAGGAATGGCTGGAGAGGAAGGG + Intronic
1114557707 14:23571319-23571341 CAGGGTTGGCGGGAGGAGGCAGG + Exonic
1114567185 14:23641357-23641379 CTGGAGTCGCTGGAGAAGGATGG - Intronic
1115095235 14:29627364-29627386 CTGGAGAGGCTGCAGAAGGATGG + Intronic
1115235507 14:31206361-31206383 CAGTTTTGGGTAGAGAAGGAGGG - Intronic
1116654728 14:47637975-47637997 CAGGATTTGATTGAGAATGATGG - Intronic
1116744955 14:48805884-48805906 CAGGTTTGGCTGGCGTGGGATGG - Intergenic
1117276485 14:54199078-54199100 CATTATTTGATGGAGAAGGAAGG + Intergenic
1117581882 14:57159391-57159413 CAGGATTTGCTGGAGTAGAAAGG + Intergenic
1117872223 14:60213096-60213118 CAGAAGTGGCTTGAGAAGAAGGG - Intergenic
1118722462 14:68604182-68604204 CGAGAGTGGCTGGAGAAGGTGGG + Intronic
1118927161 14:70202534-70202556 CAGAATTGGCATGTGAAGGAAGG - Intergenic
1119920442 14:78441365-78441387 AAGGATTGGTAGGAAAAGGAAGG - Intronic
1122274209 14:100583000-100583022 CAGGGGTGGATGGTGAAGGACGG - Intronic
1122413531 14:101537929-101537951 CAGGAAAGGCTGGAGAGAGAGGG + Intergenic
1122414362 14:101541832-101541854 CAGGATGGGCAGGGGAGGGAAGG - Intergenic
1122977826 14:105178216-105178238 CAGGAGTGGATGGGGAAGGGTGG + Intronic
1125246273 15:37644782-37644804 CAGGAAAGCATGGAGAAGGAAGG + Intergenic
1125741703 15:41969770-41969792 AAGAATTGGCCAGAGAAGGAGGG - Intronic
1125756603 15:42069556-42069578 CAGCCTGGGCTGGGGAAGGATGG + Intronic
1125798801 15:42425948-42425970 CAGGGTTGGCTGGGGGATGAAGG - Intronic
1126112227 15:45182082-45182104 CAGGAGAGGCTTGAGCAGGAAGG - Intronic
1126859596 15:52871041-52871063 CAGAAGTGCCTGGAGAAAGAAGG - Intergenic
1128115514 15:65102479-65102501 CAGGAGAGGCCGGAGGAGGAGGG - Exonic
1128519132 15:68364166-68364188 CAGGATTAGATGAAGAAGGCTGG - Intronic
1128756913 15:70189503-70189525 CAGGATTGGCTGGCATAGGATGG + Intergenic
1129239806 15:74244585-74244607 TAGAAGTGACTGGAGAAGGAGGG - Intronic
1130579788 15:85125725-85125747 CAGGACTGGGTTGAGAAGTACGG + Intronic
1130968441 15:88714415-88714437 CATGAGTGGCTGGAGAGGAAGGG + Intergenic
1131073009 15:89477645-89477667 CAGGAATGGCTGGAGACGGGAGG + Exonic
1131473309 15:92714739-92714761 GAGGAGCCGCTGGAGAAGGAAGG - Intronic
1133674984 16:8062856-8062878 CAGAAATTGCTGGAAAAGGAGGG - Intergenic
1133835698 16:9365542-9365564 CAGGAGAGGCTGGTGCAGGAAGG + Intergenic
1134754700 16:16656541-16656563 GAGGACTGGCTGGAGAATAATGG + Intergenic
1134991360 16:18702501-18702523 GAGGACTGGCTGGAGAATAATGG - Intergenic
1135469689 16:22719122-22719144 CCGGCATGGCTGGAGAAAGAGGG - Intergenic
1135983815 16:27169025-27169047 CAGGATTGTAGTGAGAAGGATGG + Intergenic
1136014173 16:27384173-27384195 CAGAATTGGCTGAAAGAGGAAGG - Intergenic
1136139762 16:28281289-28281311 CAGGCTGGGGTGGAGCAGGAGGG - Intergenic
1137380598 16:47995516-47995538 ATGGATAGGCTGGAGAAGCATGG - Intergenic
1137432227 16:48427657-48427679 CAGGATAGGCAGGAGAAACAAGG - Intronic
1137462789 16:48680532-48680554 CAGCATTGGGAGCAGAAGGAAGG - Intergenic
1137531422 16:49281152-49281174 CAGATTGGGCTGGTGAAGGAGGG - Intronic
1137547676 16:49415707-49415729 CAGGTTGGGCTGCAGAGGGAGGG + Intergenic
1139228284 16:65254590-65254612 CAGGATGAGCTAGAGAACGAAGG - Intergenic
1139357607 16:66376640-66376662 CAGGACTGACAGGAGAGGGAAGG - Intronic
1139461910 16:67129195-67129217 CAGGAGGGGCTGTGGAAGGAAGG - Intronic
1139800927 16:69522117-69522139 GAAGAATGGATGGAGAAGGAGGG + Intergenic
1140514350 16:75531439-75531461 CAGCATGGGCTCCAGAAGGAGGG + Exonic
1140615125 16:76653862-76653884 CAGGATGGGCTGGAAAAGATAGG + Intergenic
1140918428 16:79514689-79514711 CAGAATTGGATAGAGAAGGATGG - Intergenic
1140958048 16:79885696-79885718 CAGGAAGTGATGGAGAAGGACGG - Intergenic
1141125484 16:81397918-81397940 CAGGAATTGCTGGTGAAGGCAGG - Intergenic
1143016869 17:3895463-3895485 CAGGTGTGTCTGGAGAAAGAAGG + Intergenic
1143110484 17:4550120-4550142 CAGGTCTGGCTGGAGAAACATGG + Exonic
1143283915 17:5774869-5774891 CAGGCTGGTCTGGAGTAGGAGGG + Intronic
1144872070 17:18377835-18377857 TGGGCTTGGCTGGTGAAGGAGGG - Exonic
1145898246 17:28473370-28473392 CTGGAGGAGCTGGAGAAGGAAGG - Exonic
1145980169 17:29006329-29006351 CAGGATTGGGTGGAGAGGGGTGG - Intronic
1146741258 17:35285736-35285758 CAGAGCAGGCTGGAGAAGGATGG - Intergenic
1147305934 17:39564417-39564439 CAGGATTGGTGGTAGGAGGAAGG - Intronic
1147376834 17:40027457-40027479 CCGGTTTGGCTGTGGAAGGACGG + Exonic
1148094090 17:45040490-45040512 CTGGCTTGGCTGGAGGCGGAAGG + Intronic
1148220555 17:45858736-45858758 CAGCTGTGGCTGGAGAGGGAGGG + Intergenic
1148453632 17:47798205-47798227 CAGGATTGGGTGGAGAAGGAAGG - Intergenic
1148561634 17:48610003-48610025 CGGGGTTGGCTGGAGAGGAAGGG + Intronic
1148615174 17:48996198-48996220 CAGGAACGGCGGGAGGAGGAGGG + Intergenic
1148753091 17:49957156-49957178 CAGGATTAGCTGGAGAATAAAGG + Intergenic
1148797783 17:50205386-50205408 CAAGAGTGGCCAGAGAAGGAGGG + Intergenic
1148859204 17:50595314-50595336 GTGGATGGGCCGGAGAAGGAAGG + Intronic
1148904085 17:50900584-50900606 CAGTAGTGGCGGGAGAAGGCTGG + Intergenic
1150342385 17:64378948-64378970 AAGGCCTGGGTGGAGAAGGAGGG - Intronic
1150412442 17:64956574-64956596 CTGTGTTGGCTGGAGAGGGATGG + Intergenic
1150638310 17:66932084-66932106 CAGGGTGAGCTGGTGAAGGAAGG - Intergenic
1150719183 17:67599733-67599755 GATGCTTGGCTGTAGAAGGAAGG + Intronic
1150799453 17:68269049-68269071 CTGTGTTGGCTGGAGAGGGATGG - Exonic
1151268740 17:72977173-72977195 CATGACTGGCTGAAGAAGCAGGG + Intronic
1151825287 17:76520618-76520640 CAGGATGGACTGGGGAAGGCAGG + Intergenic
1152081478 17:78190228-78190250 GAGGCTGGGCTGGAGGAGGAGGG - Intronic
1152125454 17:78443989-78444011 AAGGATGGGCTGTTGAAGGAAGG - Intronic
1152732718 17:81980514-81980536 CAAGAGAGACTGGAGAAGGATGG - Intronic
1154341091 18:13502945-13502967 GAGGAAAGGCTTGAGAAGGAAGG + Intronic
1155107482 18:22681980-22682002 GAGAGTTGGCTGGAGAAGGGAGG - Intergenic
1155342814 18:24830174-24830196 CAGGTTGGGGTGGAGGAGGAGGG - Intergenic
1155853362 18:30800492-30800514 CTGGAATGAATGGAGAAGGAAGG + Intergenic
1155886392 18:31214288-31214310 CAGGATAGGCTTGAGAAGGCTGG - Intergenic
1156070050 18:33196201-33196223 CAGGAGGGGCTGGAGAATAAAGG + Intronic
1156235416 18:35198821-35198843 TAGGAGTGGCAGGAGAAGCAGGG + Intergenic
1156460342 18:37318189-37318211 CAGCAGTGGCCGCAGAAGGAGGG - Intronic
1156492551 18:37505007-37505029 CTGCAGTGGCTGGAGGAGGATGG - Intronic
1156508267 18:37612951-37612973 AAGGACTGGCTTGAGAAGAAGGG + Intergenic
1157127339 18:44969462-44969484 CAGGAAAGGCTTGGGAAGGAGGG - Intronic
1157167961 18:45375809-45375831 TAGGATTGGCTGGAGAGATAAGG - Intronic
1157522950 18:48357684-48357706 CATGACTGGCTGGAGGAGGTGGG - Intronic
1157886488 18:51371852-51371874 CAAGTTTGCATGGAGAAGGAGGG - Intergenic
1158013456 18:52755946-52755968 CACACTTGGCTGGAGAGGGAAGG + Intronic
1158920539 18:62187086-62187108 CATGATTGGTCAGAGAAGGAAGG - Intronic
1159666816 18:71171413-71171435 CAGGATTGCCTGGAGAACTAGGG + Intergenic
1161631231 19:5357057-5357079 CAAGAGTGGCTGGGGCAGGACGG + Intergenic
1161915788 19:7226874-7226896 CAAAATTGGCAGGAGGAGGAGGG - Intronic
1161988097 19:7668936-7668958 CAGTAAGGGCTGGAGGAGGAAGG - Intergenic
1162218233 19:9154100-9154122 AAGGATTGCCTTGAGAAGGGAGG + Intronic
1163528752 19:17837205-17837227 CAGGAATGACTGGGGAAGGTGGG + Exonic
1163755636 19:19104797-19104819 CAAGATTGGGGGGAAAAGGAGGG + Intronic
1164671503 19:30074678-30074700 CAGGAGAGACTGGAGGAGGAAGG - Intergenic
1164913283 19:32029298-32029320 CAGGAGTGGCTTGGGAAGGACGG - Intergenic
1167535750 19:50050491-50050513 AAGGATTGGCTGGAGTAGGCGGG - Intronic
1167665250 19:50819734-50819756 CTGGATGGGCGGGGGAAGGAGGG + Intronic
1167908670 19:52683643-52683665 CAGGACTGGCTGAAGATGCAGGG + Intronic
1168298191 19:55388123-55388145 CAATATGGGCTGGAGAGGGATGG + Intronic
925360586 2:3277922-3277944 CATGAATGGCTGGAGAACGCAGG - Intronic
925854675 2:8118051-8118073 CAGAATTGGAAGGAGAATGATGG - Intergenic
926186490 2:10694931-10694953 CGGCACTGGCTGGAAAAGGAAGG - Intergenic
927757047 2:25717229-25717251 CAGGACTGTCTAGAGAAGGAAGG - Intergenic
930046336 2:47176165-47176187 GGGGCTTGGCTGGAGGAGGATGG - Intronic
930998294 2:57749381-57749403 CATGACTGGATGGAGCAGGATGG + Intergenic
931395941 2:61888525-61888547 CTGGGTTGGCTCGGGAAGGACGG + Exonic
931427694 2:62185930-62185952 CAGGATAGGGTGGAGGGGGAGGG - Intergenic
932408183 2:71528210-71528232 CAGGACTGCCTGGAGACAGATGG + Intronic
932672667 2:73752026-73752048 TGGGATTGTCTGGAGCAGGAGGG + Intergenic
932790926 2:74654179-74654201 CCCGATTGGCTGGAGGAAGAAGG + Intergenic
933514876 2:83288083-83288105 TGGGATTGTCTGGAGAAAGAGGG - Intergenic
934039477 2:88116018-88116040 CAGGAGAGGCTGGTGCAGGATGG + Intergenic
934855947 2:97730370-97730392 GAAGATTGGCTGGAGCTGGATGG + Intronic
935727428 2:106036058-106036080 GAGGCTTTGCTGAAGAAGGAAGG - Intergenic
936249427 2:110856271-110856293 CAGGATGGGATGGAGCAGGATGG - Intronic
936252461 2:110877145-110877167 CTGGCTGTGCTGGAGAAGGAGGG - Intronic
936376068 2:111942453-111942475 CAGGAAGGGCTGAAGAAAGATGG - Intronic
936683726 2:114804061-114804083 CAGCAATGGCTGGAGCAGGTGGG - Intronic
937743321 2:125381512-125381534 CAGGCTTGCCTGGGGAAGGATGG + Intergenic
939300614 2:140332539-140332561 CACAATTATCTGGAGAAGGAGGG - Intronic
940233751 2:151486833-151486855 TAGGATTGGATGGAGCAGAAAGG + Intronic
940567504 2:155386501-155386523 CAGGAATGGATGGAAAATGAAGG - Intergenic
940905499 2:159165795-159165817 GAGGATTGGCAGGTAAAGGAAGG + Intronic
940967245 2:159852800-159852822 CAGAAATGGCTAGAGAAGAAAGG - Intronic
941375725 2:164727136-164727158 CAGAAGTGGCTACAGAAGGAGGG + Intronic
941765498 2:169292124-169292146 CAGGATTGGCTGGAGTTGAAGGG - Intronic
941984017 2:171491713-171491735 CAGGAGTTGCTGGTAAAGGAAGG + Intergenic
942413947 2:175738892-175738914 CAAGGTTGGCAGGAAAAGGATGG - Intergenic
946487736 2:220117127-220117149 GAGGATTGGTGGGAGAACGATGG + Intergenic
946548877 2:220778144-220778166 CAGAAATGGCTGGGGAAAGAGGG + Intergenic
946552785 2:220821766-220821788 GAGGATAGGGTGGAAAAGGAAGG - Intergenic
946960992 2:224985747-224985769 CAAGATTTGTTGAAGAAGGATGG - Intronic
947700352 2:232229276-232229298 CAGGACTGGCTGTGGAATGAGGG - Intronic
948735017 2:239997812-239997834 AAGGATTGGAAGGAAAAGGAAGG - Intronic
948863105 2:240762399-240762421 CAGGAGTGGCTGGATGATGATGG - Intronic
1169959477 20:11143076-11143098 CAGGTTTGGCTGGAGGAAGATGG + Intergenic
1170029825 20:11933078-11933100 GAGGATTGGCTGGAAGAGGGAGG + Intergenic
1170955035 20:20972197-20972219 CAGCACTGGCTGGAGAATAAAGG + Intergenic
1171299003 20:24043033-24043055 CACGAGGGGCAGGAGAAGGAGGG + Intergenic
1172253502 20:33496809-33496831 CAGGATAGGGTGAAAAAGGATGG - Intronic
1172614746 20:36275674-36275696 CAAGATTGGATGGAGTAAGATGG + Intergenic
1173408803 20:42791396-42791418 CAGGGTTGGCAGGAGAAGGTGGG + Exonic
1173843355 20:46173452-46173474 AAGGATTGGCAGGAGACAGAGGG - Intergenic
1175211182 20:57356973-57356995 CAGCAATGGCAGGAGAAGGGAGG - Intronic
1175400269 20:58696259-58696281 CATGCTGGGCTGGAGAGGGAAGG - Intronic
1175966624 20:62662897-62662919 CAGAACTGGCTGGGGAAGGGAGG + Intronic
1177363871 21:20108525-20108547 CAGGATTGAGTGAACAAGGATGG + Intergenic
1177660036 21:24070895-24070917 CAGGAGGGGTGGGAGAAGGATGG - Intergenic
1177846194 21:26290139-26290161 CAGTGTTGGCTGCAGAAGGTGGG + Intergenic
1178432049 21:32525700-32525722 CAGGACTGGCTGATGAAGGGAGG + Intergenic
1178762857 21:35420825-35420847 CAGTAGTGGCTGGAGCAGGCGGG + Intronic
1178869965 21:36365156-36365178 GAGGAGTGGATGGAGAAGGAAGG + Intronic
1179200610 21:39216446-39216468 CAGGCCTGGCTGGAGAAGGGAGG - Intronic
1181466543 22:23113519-23113541 CAGGACTGGCTGGGGAAGCACGG + Intronic
1181990302 22:26832118-26832140 CAGGGCTGGATGGTGAAGGATGG - Intergenic
1182456450 22:30454038-30454060 CAGGAGTGCCTGGGGAAGCAAGG - Intronic
1182476060 22:30576921-30576943 CAGGGCTGGCTGGAGAAAGGAGG + Exonic
1183733621 22:39631542-39631564 GAGGACTGCCTGGAGGAGGAGGG + Intronic
1184037028 22:41923136-41923158 CAGGAGGGGCAGGAGAAGCAGGG + Intergenic
1184246005 22:43236037-43236059 GAGGAGTGGCTGGAGAACAAAGG - Intronic
1184254288 22:43278333-43278355 AAGGAGTGGCTGAAGAAGGCAGG + Intronic
1184319523 22:43729564-43729586 CAGGAGTGGATAGTGAAGGAAGG + Intronic
1184689564 22:46111260-46111282 CAGGATGGGCTGTGGAAGGAGGG + Intronic
1185005917 22:48276997-48277019 GAGGATGGGCTGGAGGAGGCAGG - Intergenic
949606481 3:5659516-5659538 CCTGAGTGGCTGGAGAAGGCAGG - Intergenic
949624208 3:5849345-5849367 CAAGATTGGGCAGAGAAGGAGGG - Intergenic
949958685 3:9292794-9292816 CAGTAATGGGGGGAGAAGGAAGG - Intronic
950634909 3:14307828-14307850 CAGTATGTGCTGGAGGAGGAGGG - Intergenic
952798205 3:37261905-37261927 TCAGATTGGCTGGATAAGGAGGG + Intronic
952958449 3:38575246-38575268 CAGGGACGGCTGGAGGAGGAGGG - Intronic
953026713 3:39149545-39149567 CAAGAATGGCTGGGGAAAGAGGG - Intronic
953582664 3:44171529-44171551 CAGATGTGGCTGGAGAAGAATGG - Intergenic
955092335 3:55765351-55765373 CACCAATGGCTGGAGATGGATGG - Intronic
955889062 3:63631389-63631411 CAGGGTTGGCCGGAGATTGAGGG - Intergenic
956065325 3:65391487-65391509 CAGCATTAGCTGGAGAAAGGTGG - Intronic
956500262 3:69875181-69875203 CAGCAATGGCTCGAGGAGGAGGG - Intronic
958725642 3:97902609-97902631 CAGGATTTGCTGGGGAGTGAGGG - Intronic
959168732 3:102817086-102817108 CAGGATTTAGGGGAGAAGGAAGG - Intergenic
959439547 3:106359448-106359470 CAGGTTGGGGTGGAGAAGGCAGG - Intergenic
959992172 3:112641857-112641879 AAGGATTCAATGGAGAAGGAAGG + Intronic
960127539 3:114016883-114016905 CAGGATTTGTTGGATAAAGAAGG - Intronic
960172557 3:114479095-114479117 CAGGATGGGGGGAAGAAGGAAGG + Intronic
960248353 3:115424746-115424768 GAGGATTGGCTGCAGCGGGAAGG - Intergenic
960567370 3:119147738-119147760 CAGGAAGGGCAAGAGAAGGATGG + Intronic
961524971 3:127490828-127490850 CTGGATGGGCTGGGGAAAGATGG - Intergenic
963080907 3:141393015-141393037 CAGGAATTGCTGCAGAAGCAAGG - Intronic
963081136 3:141394637-141394659 CTGGATAGGCTGGTGAAGGAAGG - Intronic
964196501 3:154070925-154070947 CAGCATTGGAAGGAAAAGGATGG + Intergenic
964840297 3:160986262-160986284 CAGGAGATGCTGGAGAATGAAGG + Intronic
965953869 3:174344512-174344534 CAGGGGAGGCTGGAGAGGGATGG - Intergenic
966424667 3:179768229-179768251 AAGGTTTGGCTGCAGAGGGAAGG + Intronic
966594263 3:181712129-181712151 CAGGATCGGCCAGAGGAGGAGGG + Exonic
966820518 3:183920688-183920710 CAGGGGTGGCTGGAGACGGGTGG - Exonic
967855106 3:194111465-194111487 AAGGAGTGGCTGGGGAAGCAGGG - Intergenic
968814874 4:2817149-2817171 CAGGAGTGGCTGAATCAGGAAGG + Intronic
969308847 4:6340531-6340553 CTGGATTGGATGGAGAGGGAGGG - Intronic
970542833 4:17096433-17096455 GAGCATCTGCTGGAGAAGGAAGG - Intergenic
970994130 4:22246242-22246264 CAGGCTTGACAGCAGAAGGAAGG + Intergenic
971504200 4:27348291-27348313 CAGGAGTGGCTGCAGAAGTGAGG + Intergenic
972721716 4:41706217-41706239 CAGGATTTGGTGCAGGAGGAAGG + Intergenic
972765154 4:42146097-42146119 CAGGATTGGCTGGAGAAGGAGGG - Intronic
974067943 4:57097830-57097852 CAAGATTGGCTGGTGTACGAGGG - Intronic
974586210 4:63881608-63881630 GAGGATTGGCTGGCCTAGGAAGG + Intergenic
975431627 4:74298473-74298495 GAGGTTTGGGTGGAGGAGGAGGG - Intronic
975642184 4:76511823-76511845 CAGGTGGGGCTGGAAAAGGATGG + Intronic
976271717 4:83237337-83237359 CAGGCTTGCCTGGAGTTGGAGGG + Intergenic
978124914 4:105123973-105123995 CAGAAAAGGTTGGAGAAGGAGGG - Intergenic
978421289 4:108535876-108535898 CAAGAGAGGGTGGAGAAGGAAGG - Intergenic
980014683 4:127635602-127635624 AAGGATTGGCTGGAGAAGGGAGG + Intronic
980035862 4:127881541-127881563 GGGGATTGGCTGGAGATGGGAGG + Intronic
981722118 4:147812160-147812182 AGGGAATGGCTGGTGAAGGAGGG + Intronic
981814914 4:148819480-148819502 CAATATTTGCTGGAGAAGAATGG + Intergenic
982776287 4:159444823-159444845 CAGAAGTGACTGGACAAGGATGG - Intergenic
984688528 4:182698701-182698723 AAGGATAGGGTGGAGAAAGAGGG - Intronic
984924527 4:184794925-184794947 GAGGATTTGCTGAAGAGGGACGG + Intronic
985487126 5:158192-158214 CAGGATGGGCAGGGGGAGGAGGG - Intronic
985487145 5:158233-158255 CAGGATGGGCAGGGGGAGGAGGG - Intronic
987016429 5:13824811-13824833 CAGGATTACCTGAAGGAGGAAGG + Intronic
988294074 5:29331951-29331973 CAGGAAAAGCTGGAGGAGGATGG + Intergenic
988614956 5:32766138-32766160 CAGAGCTGGCTGGAGAAGGGCGG + Intronic
989119278 5:37987851-37987873 CAGCATGGGCTGGAGCAGGTTGG + Intergenic
993397742 5:87412197-87412219 CAGGAATGGCTGGGGAGGGTAGG - Intronic
993863035 5:93159271-93159293 GGGGAATGGGTGGAGAAGGAAGG - Intergenic
995135896 5:108679394-108679416 CAGGATTGTGTGGATAGGGAGGG + Intergenic
995177618 5:109197222-109197244 AAGGATTTGCGGGAGAAAGATGG + Intergenic
995572539 5:113495429-113495451 CAAGATGGGATGGAGATGGAGGG + Intergenic
996534604 5:124564488-124564510 GAGGATTCGCTAAAGAAGGAAGG - Intergenic
996697640 5:126416615-126416637 GAAGGTTGGCGGGAGAAGGATGG - Intronic
997584177 5:135034782-135034804 GAGAAGAGGCTGGAGAAGGAGGG - Intronic
997596222 5:135109025-135109047 GAGGATAGGCTGGAGAAGGAAGG + Intronic
999253924 5:150199079-150199101 CAGAGTTGGTCGGAGAAGGATGG + Intronic
999733194 5:154491936-154491958 CAGAATTGGGTGGGGAAGGAGGG + Intergenic
1000826110 5:166046046-166046068 CTGGATTGCCTGGGGAATGACGG - Intergenic
1001884533 5:175277525-175277547 AAGGATTGGCAGAAGAAGGCAGG - Intergenic
1002160231 5:177310590-177310612 CAGGAATGGCAGGGGAGGGAAGG + Intronic
1003241750 6:4351219-4351241 CAGGAGCTGCTGGGGAAGGAGGG - Intergenic
1003291362 6:4781187-4781209 CAGGATTTGCAGGGGAAGGTAGG + Intronic
1005495213 6:26382361-26382383 CAGGCATGGCTGGAGTGGGAGGG - Intergenic
1005499919 6:26420963-26420985 CAGGCATGGCTGGAGCGGGAGGG - Intergenic
1005622838 6:27635748-27635770 CAGCATTGACTGGAAAAGAATGG - Intergenic
1006085284 6:31590667-31590689 CTGAACTGGCTGGAGAATGATGG - Intronic
1006249740 6:32771867-32771889 CAAGAATGGCTTGTGAAGGAGGG + Intergenic
1006286009 6:33094876-33094898 AAGGATGGGCTGGAGGAGGCGGG + Intergenic
1006465269 6:34190134-34190156 CAGGAGTATCTGGAGAAGAAGGG + Intergenic
1006576021 6:35046903-35046925 GAGGACTGGCTGGCTAAGGAAGG - Intronic
1006717957 6:36132105-36132127 AGGGGTTTGCTGGAGAAGGATGG - Intronic
1006919379 6:37617387-37617409 CAGGATTTGGTGAGGAAGGAAGG - Intergenic
1007158681 6:39771234-39771256 CAGGGTAGGGTGGAGGAGGATGG - Intergenic
1007945833 6:45826092-45826114 CAGTGTGGGCTGGAGAAGTAGGG - Intergenic
1008637364 6:53424282-53424304 CAGGATGGAATGGAGAAGAAGGG + Intergenic
1009472409 6:64043989-64044011 CAGGAGTTGCAGGGGAAGGAAGG - Intronic
1009815987 6:68736118-68736140 CAGGAGAGGCTGAAGCAGGAGGG - Intronic
1011987439 6:93466459-93466481 CAGAAGTGGCTGGAGTAGAAAGG + Intergenic
1012258378 6:97060381-97060403 GAGGATGAGCTGAAGAAGGAGGG + Intronic
1012502070 6:99899285-99899307 GAGTATTGGTGGGAGAAGGAGGG - Intergenic
1012981971 6:105840669-105840691 CAGGAAGAGCTGTAGAAGGAGGG - Intergenic
1013159052 6:107523651-107523673 CAGGACTGGCTGGAGCAGCGAGG + Intronic
1013423390 6:109987333-109987355 CAGGCTTGACAGGAGGAGGATGG + Intergenic
1013851874 6:114526020-114526042 GACCATTGGCTGGAAAAGGAGGG - Intergenic
1014016840 6:116540914-116540936 CAGGATGGGCTCTGGAAGGAGGG + Intronic
1016001428 6:139045285-139045307 GAAAATTGGATGGAGAAGGAGGG + Intergenic
1017212832 6:151875979-151876001 AAGGATTGGCGGGGGAAGGCTGG + Intronic
1017251562 6:152285570-152285592 CTGGAGTGGCTGAAGAAGGCTGG - Intronic
1018437359 6:163774476-163774498 GAGGATTGGGTGGAGAAGGCCGG + Intergenic
1019471868 7:1225343-1225365 CTGGAGTGGCGGCAGAAGGAGGG + Intergenic
1019706090 7:2497947-2497969 CAGGGTCTGCTGGGGAAGGAGGG + Intergenic
1023967606 7:44971010-44971032 GAGGGTGGGCTGCAGAAGGAGGG - Exonic
1024310224 7:47962311-47962333 AAGGAAGGGCTGGAGGAGGATGG + Intronic
1024766260 7:52664475-52664497 CTGGAGTGGCTGGAGCAGGAGGG - Intergenic
1026398309 7:69982441-69982463 CAGGATAGCCTGGAGCAGGAGGG - Intronic
1026400955 7:70012235-70012257 CAGGATTGGCTGGAGGAGGCAGG + Intronic
1027758973 7:82253109-82253131 GAGGAATGGCTGGAGAAGAAGGG + Intronic
1028093176 7:86728485-86728507 CCCCATTGCCTGGAGAAGGAAGG - Intronic
1029249476 7:99225786-99225808 CAGGATGGGGTGGAAAAGGATGG - Intergenic
1029649751 7:101883277-101883299 CAGGATTGGGATGAAAAGGATGG - Intronic
1030663557 7:112249227-112249249 CAGGATGGGCTGAGGCAGGAGGG + Intronic
1030696165 7:112587938-112587960 CCGGATGGTCTGGACAAGGAAGG + Intergenic
1031918135 7:127582267-127582289 CAGGATCGGCTGCTGGAGGAGGG - Exonic
1032108563 7:129055379-129055401 AAGGATTCTCTGGAGAGGGATGG - Intergenic
1034116361 7:148587191-148587213 CAGGATGGGCAAGAGAAAGATGG + Intergenic
1034526208 7:151664449-151664471 AGGGCTTGGCTGGAGGAGGAGGG - Intronic
1035651572 8:1269698-1269720 CAAGATTGGCTGGGGGAGGGGGG - Intergenic
1035987906 8:4454586-4454608 TAGGGCTGGCTGGGGAAGGAGGG + Intronic
1037138777 8:15495259-15495281 CAGTCTTGGCTGGAGTAGAAAGG + Intronic
1037756023 8:21710538-21710560 CAGCATGGCATGGAGAAGGACGG - Intronic
1038055839 8:23856698-23856720 CAGCACTGGCTGGAGATGGGGGG + Intergenic
1038188675 8:25298930-25298952 CAGGATTGACTGAACAAAGAGGG - Exonic
1040018543 8:42720071-42720093 CAGGGTTGCGTGGGGAAGGAAGG - Intronic
1040664543 8:49617762-49617784 CAGGACTGGCTGGGGAAGGGAGG - Intergenic
1040900786 8:52414972-52414994 CAGGTTTGGCTGGATGAAGAAGG - Intronic
1043494174 8:80781898-80781920 GAAGAATGGCTGGAGAATGATGG + Intronic
1044865596 8:96568160-96568182 CAGGCTTTGCTGGAGAAAGAGGG - Intronic
1045528414 8:102961385-102961407 CCAGATTGGCTGGAGAAGAAGGG + Intronic
1045998882 8:108395944-108395966 CAGGATTGGGGGGTGAGGGATGG + Intronic
1046671836 8:117064762-117064784 GAGGAGGGGCTGGGGAAGGAGGG - Intronic
1046809580 8:118517844-118517866 CAGAATGGGCTGGGGGAGGAGGG + Intronic
1047421648 8:124712542-124712564 CAGGATTGGGTGGGGAAGGGTGG - Intronic
1049071685 8:140360069-140360091 CAGCATGGTCTGTAGAAGGAAGG + Exonic
1049236463 8:141514741-141514763 CTGGAGTGGCTACAGAAGGAGGG - Exonic
1049296870 8:141845448-141845470 CAGGATTCTCTGTAGAGGGAGGG - Intergenic
1050859540 9:10409366-10409388 AAGGATTAACTGGAGAGGGAAGG - Intronic
1051142004 9:13988018-13988040 CAGGGCTGGCTGGAGAAAGGAGG - Intergenic
1052318635 9:27143392-27143414 CAGGGTTGAGTGGAGAAGGGAGG + Intronic
1054832870 9:69645665-69645687 CAGCAGTGGCAGGAGAAGGGTGG + Intronic
1054885661 9:70195591-70195613 CTGGGTAGGATGGAGAAGGATGG - Intronic
1056499874 9:87198197-87198219 CAGGATCGACTGGGGAATGACGG + Intergenic
1056501482 9:87214007-87214029 CAGGCATGGCTGGAGAAAGGAGG + Intergenic
1057020970 9:91697458-91697480 CAGGAAGGGCTGGGGAAGGTGGG + Intronic
1057083028 9:92187020-92187042 TGGGATTTGCTGGAGGAGGAAGG + Intergenic
1058465615 9:105224390-105224412 TAGAATTGCCTTGAGAAGGATGG - Intergenic
1059743915 9:117181962-117181984 CAGCATGGGGTGGGGAAGGAGGG - Intronic
1059953174 9:119489019-119489041 CAGGACTGTCTGCAGAAGGAAGG - Intergenic
1060247394 9:121957888-121957910 CAGGATTGGGAAGAGAAGGAGGG + Intronic
1061201109 9:129139022-129139044 CAGGATAAGCTGGAGGAGCAGGG + Intronic
1061568162 9:131458071-131458093 CAGGGGTGGCTGGACAAGAAGGG - Intronic
1061574570 9:131497924-131497946 CAGGAATGGCTTGGCAAGGAGGG - Exonic
1061967647 9:134025284-134025306 GAGGAGGGGCTGGAGGAGGAGGG - Intergenic
1061967653 9:134025299-134025321 GAGGAGGGGCTGGAGGAGGAGGG - Intergenic
1062212874 9:135373981-135374003 GGGGAATGGCTGGAGATGGATGG + Intergenic
1062273453 9:135720121-135720143 CAGGAATGGGTGCAGAAGGAGGG + Intronic
1203780114 EBV:96290-96312 CAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780133 EBV:96341-96363 CAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780138 EBV:96356-96378 CAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780143 EBV:96371-96393 CAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780148 EBV:96386-96408 CAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780157 EBV:96410-96432 CAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780166 EBV:96434-96456 CAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780195 EBV:96512-96534 CAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780204 EBV:96536-96558 CAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780213 EBV:96560-96582 CAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1186133658 X:6496220-6496242 CAGGTTGGGATGGAGAAGGTGGG - Intergenic
1186170447 X:6871240-6871262 CAGGAGTGGGTGGAGAGAGAAGG - Intergenic
1186479281 X:9883748-9883770 GAGGATTGGCAGGAAAAGGAAGG + Intronic
1186674467 X:11801649-11801671 CAGGATCGACTTGAGAAGCACGG + Intergenic
1187182537 X:16956602-16956624 CAGGACAGACTGGAGGAGGAGGG - Intronic
1187214921 X:17266887-17266909 AATTATTGGCTGGAGGAGGAGGG + Intergenic
1187358981 X:18606689-18606711 GAGCATTGGAAGGAGAAGGAAGG + Intronic
1187536919 X:20149437-20149459 CATGACTGGCTGGAGAATGAGGG + Intergenic
1187680525 X:21762769-21762791 CAGCATCTGCTGGGGAAGGAGGG - Intergenic
1187724732 X:22190608-22190630 CAGGGTATGCTGGTGAAGGAAGG + Intronic
1189277522 X:39797549-39797571 CAGGTCTGGCTGGAGAAAGGAGG + Intergenic
1189686305 X:43567281-43567303 CAAGATTGGCTGGAGTTGCATGG + Intergenic
1190026467 X:46928210-46928232 CAGGATTGGCAGGGCAAAGAGGG - Intronic
1191658699 X:63629028-63629050 CAGGGGTGGCTGGGGAAAGAGGG + Intergenic
1192084251 X:68080006-68080028 CAGGAGTGGCTGGAGACAGAAGG - Intronic
1192190050 X:68985536-68985558 AAGGGCTGGCTGGGGAAGGAAGG + Intergenic
1192569343 X:72190041-72190063 CAGGATTGGCGGAGGCAGGAAGG - Intronic
1192873122 X:75204047-75204069 CTGGACTTGGTGGAGAAGGATGG + Intergenic
1195719841 X:107856600-107856622 CAGGATGGGCTGGGAAAGGTTGG - Intronic
1196684477 X:118498517-118498539 CACGAGTGGCTGGAGAGTGAGGG + Intronic
1197316116 X:124967830-124967852 GAGGATGGGTTGGAGCAGGAAGG - Intergenic
1199518376 X:148705020-148705042 CTGGATTGGCTGTTGAAGGTAGG - Intronic
1199772035 X:150981252-150981274 CAGAGGTGGCTGGAGATGGAAGG + Intronic
1200226073 X:154418578-154418600 CAACATTGGCTTCAGAAGGAAGG + Intronic
1200921555 Y:8617965-8617987 CAGGTCTTGCTGGAGGAGGATGG - Intergenic
1200937272 Y:8749195-8749217 CATGTTTTGCTGGAGGAGGAGGG + Intergenic