ID: 972765184

View in Genome Browser
Species Human (GRCh38)
Location 4:42146279-42146301
Sequence AGCTTTATCTTCCACTAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 135}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972765184_972765192 25 Left 972765184 4:42146279-42146301 CCCTCCTAGTGGAAGATAAAGCT 0: 1
1: 0
2: 0
3: 10
4: 135
Right 972765192 4:42146327-42146349 TTGGTTGTAAATTCCAAACCTGG 0: 1
1: 0
2: 0
3: 9
4: 124
972765184_972765189 1 Left 972765184 4:42146279-42146301 CCCTCCTAGTGGAAGATAAAGCT 0: 1
1: 0
2: 0
3: 10
4: 135
Right 972765189 4:42146303-42146325 GGAGTGGAGAGAGAAAGACATGG 0: 1
1: 0
2: 19
3: 199
4: 1484
972765184_972765191 6 Left 972765184 4:42146279-42146301 CCCTCCTAGTGGAAGATAAAGCT 0: 1
1: 0
2: 0
3: 10
4: 135
Right 972765191 4:42146308-42146330 GGAGAGAGAAAGACATGGGTTGG 0: 1
1: 0
2: 6
3: 118
4: 894
972765184_972765190 2 Left 972765184 4:42146279-42146301 CCCTCCTAGTGGAAGATAAAGCT 0: 1
1: 0
2: 0
3: 10
4: 135
Right 972765190 4:42146304-42146326 GAGTGGAGAGAGAAAGACATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972765184 Original CRISPR AGCTTTATCTTCCACTAGGA GGG (reversed) Intronic
905516440 1:38565273-38565295 AGCTTGTTCTTCCACCAGGCTGG + Intergenic
906178265 1:43795314-43795336 TGATCTATCTTCCACTAAGAGGG - Intronic
908033340 1:60025312-60025334 AGCTTTAACTTCAAATATGATGG - Intronic
908516749 1:64900355-64900377 ACCTTTATCTTCACCTAGAATGG - Intronic
909021743 1:70439103-70439125 AGCTGTGACTTCCACTTGGAGGG - Exonic
909258198 1:73451322-73451344 AGCTTTATCTTCTACATCGAAGG + Intergenic
912086845 1:106017397-106017419 AGCTTTATCTCTCTCTGGGAAGG - Intergenic
913376177 1:118155092-118155114 GGCTTTATCAATCACTAGGAGGG - Intronic
917161794 1:172065482-172065504 AGCTATCTCTTCCACTCTGAAGG + Intronic
918230558 1:182527346-182527368 TCCTTCATCTTCCATTAGGAAGG + Intronic
919218698 1:194596311-194596333 AGCATTATCTACCACTATTAAGG - Intergenic
919489264 1:198185409-198185431 AACTTTATATTCCTCTAGCAGGG + Intronic
920759747 1:208771604-208771626 AACTTTATTTTCTACTGGGAGGG + Intergenic
922329836 1:224564778-224564800 TGCTCTACCTTCCACAAGGATGG + Intronic
1072142043 10:92597580-92597602 ACCTTGATCTTGCACTATGATGG + Intronic
1072902510 10:99421015-99421037 AGCTGTAAGTTCCACAAGGATGG - Intronic
1074102724 10:110366282-110366304 AGCTTCATCTTCCTCACGGAAGG - Intergenic
1074937852 10:118203750-118203772 AACTCTTTCTTCCACAAGGACGG + Intergenic
1077816410 11:5690168-5690190 AGCTTTATTTCCAACAAGGAAGG - Intronic
1078035809 11:7804022-7804044 AGCCTTAACTTCCAATATGATGG + Intergenic
1081201788 11:40225499-40225521 ATCTGTATCTTCCACTAGTTAGG - Intronic
1083371707 11:62187591-62187613 ATCTGTATATTCCATTAGGAAGG - Intergenic
1085324512 11:75596311-75596333 ATCTGTATATTCCACAAGGAGGG - Intronic
1085709751 11:78818566-78818588 ATATTTTTCTTCCACTTGGAGGG + Intronic
1087700413 11:101430834-101430856 TGCTTTATCTTCTACCAAGAGGG - Intergenic
1089422189 11:118340207-118340229 AGCTCTCTCTTCCACTTTGAAGG + Intronic
1091370214 11:135051360-135051382 AGCTTCTTCTTCCTCCAGGATGG - Intergenic
1091698309 12:2642827-2642849 AGTTTCATCTTCCCCTGGGAAGG - Intronic
1093936360 12:25005223-25005245 AACTTTTTCTTCTAATAGGATGG + Intergenic
1096408793 12:51362522-51362544 AGCTTTGTCTTCCAGTTGTATGG + Intronic
1096516892 12:52161389-52161411 GCCTTTATTTTCCAATAGGATGG + Intergenic
1099328990 12:81257180-81257202 TGGGTTATTTTCCACTAGGATGG + Exonic
1102156435 12:110733259-110733281 AGCTTTATTTTTGGCTAGGAAGG + Intronic
1108190627 13:47934815-47934837 TGCTTTTTCTTCCTCTGGGAGGG - Intergenic
1108403677 13:50078864-50078886 AGCTTTAAATTCCACCAGGCTGG - Intergenic
1108472121 13:50777883-50777905 AACTTTATATTTCATTAGGAGGG + Intronic
1110664962 13:78106188-78106210 AGGGTTCTCTTCCACGAGGAGGG - Intergenic
1111867729 13:93790727-93790749 TGCTGTCTCTTCCACTAGGTTGG - Intronic
1111952031 13:94716264-94716286 TGCTTTCTCTTCCACAAGGGAGG + Intergenic
1114883674 14:26819459-26819481 AGATTTATCTGCCCCTAGGTAGG + Intergenic
1119585951 14:75835104-75835126 AGCTTTGACTTCCTCTAGTAAGG + Intronic
1124255177 15:28135306-28135328 AGTTTTATGTTCCAATACGAAGG - Intronic
1124715378 15:32055631-32055653 AAATTTAATTTCCACTAGGATGG - Intronic
1130023154 15:80248009-80248031 AGACTTATCTTCCAAGAGGAGGG + Intergenic
1132259087 15:100406126-100406148 TCCTTTATCTTCCACAATGAGGG - Intronic
1132323420 15:100944455-100944477 AGCATTATCTTTTACAAGGATGG + Intronic
1134572537 16:15303665-15303687 AGCCTTAACTTCCATTATGATGG + Intergenic
1134937584 16:18259527-18259549 AGCCTTAACTTCCATTATGATGG + Intergenic
1137550645 16:49435223-49435245 AGCTTTTCCTTCCACTCAGAGGG + Intergenic
1145033681 17:19525044-19525066 GGCTTTTTCTCCCACTGGGAAGG + Intronic
1152318671 17:79595727-79595749 ACCTTGCTCTTCCTCTAGGAGGG - Intergenic
1152974935 18:206289-206311 AACTTCATCAGCCACTAGGAAGG - Intronic
1153742534 18:8144024-8144046 AGCTTTATCTGCCACTGTGTGGG - Intronic
1153898758 18:9595508-9595530 AGCTTTATCTTCCACATTGCAGG - Intronic
1157107812 18:44791326-44791348 TTCTTTCTCTACCACTAGGACGG - Intronic
1158328917 18:56339990-56340012 AGCTTTCCCTTACACTATGAAGG + Intergenic
1166588077 19:43969030-43969052 ATCCTTATATTCCCCTAGGAAGG + Intronic
926684886 2:15690926-15690948 GGCTTTATCTCCCACCAGGAGGG + Intronic
929102147 2:38325810-38325832 AGCTTTATCTGACCCTAGGGAGG + Intronic
929307345 2:40378637-40378659 AGCTTTCTCTTCCACAGGAAAGG - Intronic
931857775 2:66321763-66321785 CGCTTCATCATCCACTAGGATGG + Intergenic
932265711 2:70365507-70365529 AGCTTTATCATCCTTTAGCAAGG + Intergenic
932439241 2:71721367-71721389 AGCTTTTTCTTCTTCTTGGATGG - Intergenic
934062202 2:88305431-88305453 TCCTTTCTCTGCCACTAGGAAGG + Intergenic
939181458 2:138807817-138807839 AACTTTATCTTCTAATAGGAAGG - Intergenic
939685513 2:145194303-145194325 AGCTTTATCTTCTACAAAGGTGG - Intergenic
946036481 2:216746363-216746385 CGCTTTGTCTTCCACTACCAGGG - Intergenic
947812537 2:233013445-233013467 AGCATTATCTTGCACTGGGCGGG - Intronic
1169433365 20:5560072-5560094 TGCTTTCTCTTTCACTAGGATGG - Exonic
1169960587 20:11155257-11155279 AGTTTTCACTTCCGCTAGGAAGG - Intergenic
1173272456 20:41550124-41550146 AGCATAATATTCCACTAGGTGGG + Intronic
1173652898 20:44678580-44678602 AGCTCTCTCTTCCCCTGGGAAGG - Intergenic
1173776630 20:45714130-45714152 ATCTGTATATTCCCCTAGGAAGG + Intergenic
1175693946 20:61087088-61087110 AGCTGTATCTTCAGCTTGGATGG - Intergenic
1177298437 21:19207558-19207580 AGTATTTTCTTCCAGTAGGAAGG + Intergenic
1178400440 21:32280428-32280450 AGCATTTTCTTCCAGTAAGAAGG - Intergenic
950436728 3:12984641-12984663 GGCTTTATCTTTCCCCAGGAAGG - Intronic
950662728 3:14476760-14476782 ACCCTTATCTTCCACGAGGATGG + Intronic
952207855 3:31198341-31198363 AGCTTTCTCTGCCAATAGGAAGG + Intergenic
952248600 3:31626505-31626527 AATTTTATCTTACACTGGGAGGG - Intronic
957136746 3:76298120-76298142 AGCTTTTTGTTCCTCTATGATGG - Intronic
963832487 3:150023059-150023081 ACCTTTATCTTCCGCTACCAGGG - Intronic
965296632 3:166955569-166955591 ACCTTTCTCTTCCACTACCATGG + Intergenic
965673159 3:171168004-171168026 AAATTTATCTTCCTCTAGAAAGG + Intronic
965955215 3:174361474-174361496 AACTCTATCTTCCAATATGATGG + Intergenic
966218717 3:177529251-177529273 TGCTTTATTATCCTCTAGGAGGG - Intergenic
967274538 3:187761000-187761022 AACTTTATCTTCCACCATGCTGG - Intergenic
970658605 4:18260113-18260135 TCCTTTATCTTCCACTACCAGGG + Intergenic
971371073 4:26019397-26019419 AGTTTTATCATCCACTGGGAGGG + Intergenic
972385482 4:38561662-38561684 TGCTTTGCCTTCCACCAGGATGG + Intergenic
972765184 4:42146279-42146301 AGCTTTATCTTCCACTAGGAGGG - Intronic
973815495 4:54615372-54615394 AGCTTTATGTATTACTAGGAAGG - Intergenic
978992894 4:115108438-115108460 CTCTTTTTCTTCCACTAGCATGG + Intronic
979296760 4:119041763-119041785 AGCTATATGTTACACTACGAAGG - Intronic
982964861 4:161893223-161893245 AACTTTATGTTCCATTTGGATGG + Intronic
988436029 5:31176722-31176744 CGATTTATCTTCAACTATGAAGG + Intergenic
990704690 5:58515236-58515258 ATCTGTACCTTCCCCTAGGAAGG + Intergenic
992499722 5:77330076-77330098 ATCTTAATCTCCCACCAGGATGG - Intronic
993809341 5:92456503-92456525 AGCTATATGTTCAACTAAGAGGG - Intergenic
998775261 5:145592897-145592919 AGGTATATATTCCAATAGGAAGG - Intronic
999079979 5:148834041-148834063 ATCTTTTTCATCCACTAGCAAGG - Intergenic
999670133 5:153952447-153952469 AGCTACATCTTCCCCTAGGAGGG + Intergenic
1002494689 5:179603711-179603733 AGGTCTATGGTCCACTAGGAGGG - Intronic
1002535798 5:179874730-179874752 TGCTTCATCTCCCACTAGAAAGG + Intronic
1003251107 6:4429861-4429883 ACCTCTATCTTCCCTTAGGAAGG + Intergenic
1003450900 6:6230508-6230530 CCCTTTGTCTTCCACTAGCAGGG - Intronic
1003958606 6:11189261-11189283 AGCTTTCCCTTCCACTTTGAGGG - Intronic
1004475888 6:15970699-15970721 AGGCTTATCTTCCACAAGTATGG + Intergenic
1008000758 6:46357205-46357227 AAGTTTATCTTCAGCTAGGATGG - Intronic
1008811887 6:55512203-55512225 AGCTTGCTCTTCAAATAGGAAGG - Intronic
1010917804 6:81642139-81642161 AACTCTTTCTTCCCCTAGGATGG + Intronic
1011094685 6:83647207-83647229 AGCTAGAACTTCCAGTAGGATGG + Intronic
1011789707 6:90885355-90885377 CCCTTTATCTTCCACTACCAGGG + Intergenic
1012153194 6:95781811-95781833 AGATTTATCTTCCTCTTGTAGGG + Intergenic
1013425761 6:110011321-110011343 AGTTTTATCTTACAGTAGGGGGG - Intergenic
1014755513 6:125298363-125298385 AGCCTTATCTTCCAGAAGCAGGG - Intronic
1019813580 7:3183000-3183022 AGCTGCATCTTCCAAGAGGAAGG - Intergenic
1021072599 7:16260275-16260297 AGATTTATTTTCCAGTAAGATGG + Intronic
1022996233 7:35758268-35758290 ATTTTTATCTTCCACAGGGATGG - Intergenic
1023245782 7:38202148-38202170 TGCTGTACCTTCCACTAGGGTGG + Intronic
1023748952 7:43351440-43351462 CCCTTTATCTTCCACTACCAGGG + Intronic
1024592007 7:50895228-50895250 AGTTTTATCTTCCTCTAGAACGG + Intergenic
1028349412 7:89826709-89826731 ATCTTTCTCTTCCACTTGGAAGG + Intergenic
1032201168 7:129824136-129824158 AGCTTTGACTTCCATTTGGAAGG - Intergenic
1032618029 7:133496597-133496619 ACCTTTATCTTCCACCTCGAAGG - Intronic
1033940910 7:146652237-146652259 AACTTTATATTACAGTAGGAAGG - Intronic
1034105624 7:148487149-148487171 AGCTTTGTCTCTCACTGGGAGGG - Intergenic
1035456020 7:159009339-159009361 GGATTTTTCCTCCACTAGGATGG - Intergenic
1038957941 8:32487504-32487526 AGCTTTTGATTCCACTAGGGTGG + Intronic
1039464304 8:37772913-37772935 AGATTTTTCTTCCTTTAGGATGG + Intronic
1045393900 8:101741532-101741554 AGCTGTATCTTCAATGAGGAAGG - Intronic
1046111795 8:109734360-109734382 AGCTTTTTTTTCCAGTAAGAAGG - Intergenic
1046332106 8:112731416-112731438 TGCTTTATCTTCCATCAGTATGG + Intronic
1049742604 8:144248319-144248341 AGCTTTCTCATCCCCTTGGAAGG - Intronic
1051171298 9:14320825-14320847 AACTTTAACTTCCAATAGGCGGG - Intronic
1056436763 9:86581742-86581764 ATCTTTATCTTCCACAGGGCCGG + Intergenic
1187915079 X:24146219-24146241 ATATTTATCTTCCCCTAGAAAGG - Intergenic
1188949788 X:36356761-36356783 TGCTTTAATTTCCACTAGAAGGG - Intronic
1188986019 X:36769040-36769062 TGCTGTATCCTCCACTAGGCAGG + Intergenic
1189573060 X:42320322-42320344 AGATTTAGCTTCCACAAGGCAGG + Intergenic
1189685280 X:43557323-43557345 AGCTGTATCTTCTAGTAAGAAGG - Intergenic
1190895458 X:54613999-54614021 ACCTTTGTCTTCCACTACCAGGG + Intergenic
1191599557 X:62987886-62987908 TGCTTTTACTTCCACCAGGATGG - Intergenic
1193643867 X:84043924-84043946 TCCTTTGTCTTCCACTAGCAGGG + Intergenic
1194671102 X:96733551-96733573 AACTTTGACTTGCACTAGGAGGG + Intronic
1198142442 X:133818139-133818161 CGATTTATATTCCACTAGCAAGG + Intronic