ID: 972766173

View in Genome Browser
Species Human (GRCh38)
Location 4:42153456-42153478
Sequence CAACCAGCATACCCTGCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972766169_972766173 -9 Left 972766169 4:42153442-42153464 CCCCTCTTCTAGGCCAACCAGCA 0: 1
1: 0
2: 0
3: 8
4: 162
Right 972766173 4:42153456-42153478 CAACCAGCATACCCTGCCCCAGG No data
972766170_972766173 -10 Left 972766170 4:42153443-42153465 CCCTCTTCTAGGCCAACCAGCAT No data
Right 972766173 4:42153456-42153478 CAACCAGCATACCCTGCCCCAGG No data
972766168_972766173 -1 Left 972766168 4:42153434-42153456 CCAAATCACCCCTCTTCTAGGCC No data
Right 972766173 4:42153456-42153478 CAACCAGCATACCCTGCCCCAGG No data
972766163_972766173 14 Left 972766163 4:42153419-42153441 CCATTGCTCCCTATCCCAAATCA No data
Right 972766173 4:42153456-42153478 CAACCAGCATACCCTGCCCCAGG No data
972766167_972766173 0 Left 972766167 4:42153433-42153455 CCCAAATCACCCCTCTTCTAGGC No data
Right 972766173 4:42153456-42153478 CAACCAGCATACCCTGCCCCAGG No data
972766164_972766173 6 Left 972766164 4:42153427-42153449 CCCTATCCCAAATCACCCCTCTT No data
Right 972766173 4:42153456-42153478 CAACCAGCATACCCTGCCCCAGG No data
972766165_972766173 5 Left 972766165 4:42153428-42153450 CCTATCCCAAATCACCCCTCTTC No data
Right 972766173 4:42153456-42153478 CAACCAGCATACCCTGCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972766173 Original CRISPR CAACCAGCATACCCTGCCCC AGG Intergenic
No off target data available for this crispr