ID: 972766889

View in Genome Browser
Species Human (GRCh38)
Location 4:42159466-42159488
Sequence CAGTGACGATGGAAGGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972766881_972766889 27 Left 972766881 4:42159416-42159438 CCTGGCAGCAGTCTAAATGAGAG No data
Right 972766889 4:42159466-42159488 CAGTGACGATGGAAGGAAGTGGG No data
972766883_972766889 4 Left 972766883 4:42159439-42159461 CCAAGACTGCTTGGACCAGTGTA No data
Right 972766889 4:42159466-42159488 CAGTGACGATGGAAGGAAGTGGG No data
972766880_972766889 28 Left 972766880 4:42159415-42159437 CCCTGGCAGCAGTCTAAATGAGA No data
Right 972766889 4:42159466-42159488 CAGTGACGATGGAAGGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972766889 Original CRISPR CAGTGACGATGGAAGGAAGT GGG Intergenic
No off target data available for this crispr