ID: 972768264

View in Genome Browser
Species Human (GRCh38)
Location 4:42171712-42171734
Sequence AGACATCAGACTAAGTGTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972768264_972768269 6 Left 972768264 4:42171712-42171734 CCTAAACACTTAGTCTGATGTCT No data
Right 972768269 4:42171741-42171763 GACCCCACACTTGGGTCTGTGGG No data
972768264_972768268 5 Left 972768264 4:42171712-42171734 CCTAAACACTTAGTCTGATGTCT No data
Right 972768268 4:42171740-42171762 CGACCCCACACTTGGGTCTGTGG No data
972768264_972768266 -3 Left 972768264 4:42171712-42171734 CCTAAACACTTAGTCTGATGTCT No data
Right 972768266 4:42171732-42171754 TCTGATGGCGACCCCACACTTGG No data
972768264_972768273 19 Left 972768264 4:42171712-42171734 CCTAAACACTTAGTCTGATGTCT No data
Right 972768273 4:42171754-42171776 GGTCTGTGGGCAATAACTCCAGG No data
972768264_972768267 -2 Left 972768264 4:42171712-42171734 CCTAAACACTTAGTCTGATGTCT No data
Right 972768267 4:42171733-42171755 CTGATGGCGACCCCACACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972768264 Original CRISPR AGACATCAGACTAAGTGTTT AGG (reversed) Intergenic
No off target data available for this crispr