ID: 972777908

View in Genome Browser
Species Human (GRCh38)
Location 4:42260367-42260389
Sequence GACACTGCTGTAACTACCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972777907_972777908 21 Left 972777907 4:42260323-42260345 CCTTATTCAACAAATAATGTGAA No data
Right 972777908 4:42260367-42260389 GACACTGCTGTAACTACCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972777908 Original CRISPR GACACTGCTGTAACTACCAC AGG Intergenic
No off target data available for this crispr