ID: 972779210

View in Genome Browser
Species Human (GRCh38)
Location 4:42271357-42271379
Sequence CTGTAGCTCCTGAGGGGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972779210_972779216 -2 Left 972779210 4:42271357-42271379 CCACCTCCCCTCAGGAGCTACAG No data
Right 972779216 4:42271378-42271400 AGGCTCTATTTCCTTGTGTACGG No data
972779210_972779218 20 Left 972779210 4:42271357-42271379 CCACCTCCCCTCAGGAGCTACAG No data
Right 972779218 4:42271400-42271422 GTGTAAAAACTTCAGTCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972779210 Original CRISPR CTGTAGCTCCTGAGGGGAGG TGG (reversed) Intergenic
No off target data available for this crispr