ID: 972786238

View in Genome Browser
Species Human (GRCh38)
Location 4:42329113-42329135
Sequence CACCCTATAAGGGCTGGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972786238_972786247 21 Left 972786238 4:42329113-42329135 CCACACCCAGCCCTTATAGGGTG No data
Right 972786247 4:42329157-42329179 AATATACAGCTAATCTGGATGGG No data
972786238_972786246 20 Left 972786238 4:42329113-42329135 CCACACCCAGCCCTTATAGGGTG No data
Right 972786246 4:42329156-42329178 TAATATACAGCTAATCTGGATGG No data
972786238_972786245 16 Left 972786238 4:42329113-42329135 CCACACCCAGCCCTTATAGGGTG No data
Right 972786245 4:42329152-42329174 GAGATAATATACAGCTAATCTGG No data
972786238_972786244 -6 Left 972786238 4:42329113-42329135 CCACACCCAGCCCTTATAGGGTG No data
Right 972786244 4:42329130-42329152 AGGGTGTTTATAGAGGCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972786238 Original CRISPR CACCCTATAAGGGCTGGGTG TGG (reversed) Intergenic
No off target data available for this crispr